ROBO1 Rabbit Polyclonal Antibody

ROBO1 Polyclonal Antibody
ES10191-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ROBO1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ROBO1 Polyclonal Antibody
ES10191-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ROBO1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ROBO1 Rabbit pAb
A15313-100ul 100 ul
EUR 308

ROBO1 Rabbit pAb
A15313-200ul 200 ul
EUR 459

ROBO1 Rabbit pAb
A15313-20ul 20 ul
EUR 183

ROBO1 Rabbit pAb
A15313-50ul 50 ul
EUR 223

ROBO1 Rabbit pAb
A9412-100ul 100 ul
EUR 308

ROBO1 Rabbit pAb
A9412-200ul 200 ul
EUR 459

ROBO1 Rabbit pAb
A9412-20ul 20 ul
EUR 183

ROBO1 Rabbit pAb
A9412-50ul 50 ul Ask for price

ROBO1 Rabbit pAb
A19506-100ul 100 ul Ask for price

ROBO1 Rabbit pAb
A19506-200ul 200 ul Ask for price

ROBO1 Rabbit pAb
A19506-20ul 20 ul Ask for price

ROBO1 Rabbit pAb
A19506-50ul 50 ul
EUR 308

Polyclonal ROBO1 Antibody (Internal)
APG01042G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ROBO1 (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal ROBO1 Antibody (Internal)
APG01234G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ROBO1 (Internal). This antibody is tested and proven to work in the following applications:

ROBO1 antibody
70R-21676 50 ul
EUR 435
Description: Rabbit polyclonal ROBO1 antibody

ROBO1 Antibody
46218-100ul 100ul
EUR 252

ROBO1 Antibody
46218-50ul 50ul
EUR 187

ROBO1 Antibody
1-CSB-PA896760LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ROBO1. Recognizes ROBO1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

ROBO1 Antibody
DF9877 200ul
EUR 304
Description: ROBO1 Antibody detects endogenous levels of total ROBO1.

ROBO1 Antibody
1-CSB-PA020054GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ROBO1. Recognizes ROBO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ROBO1 Antibody
ABD9877 100 ug
EUR 438

Polyclonal ROBO1 Antibody (aa1632-1644)
APR02181G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ROBO1 (aa1632-1644). This antibody is tested and proven to work in the following applications:

ROBO1
GT15144 100 ug
EUR 526

Anti-ROBO1 Antibody
A01530-2 100ug/vial
EUR 294

ROBO1 Conjugated Antibody
C46218 100ul
EUR 397

ROBO1-Specific Antibody
abx237372-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Anti-ROBO1 antibody
STJ11100699 50 µl
EUR 287
Description: Bilateral symmetric nervous systems have special midline structures that establish a partition between the two mirror image halves. Some axons project toward and across the midline in response to long-range chemoattractants emanating from the midline. The product of this gene is a member of the immunoglobulin gene superfamily and encodes an integral membrane protein that functions in axon guidance and neuronal precursor cell migration. This receptor is activated by SLIT-family proteins, resulting in a repulsive effect on glioma cell guidance in the developing brain. A related gene is located at an adjacent region on chromosome 3. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-ROBO1 antibody
STJ111690 100 µl
EUR 277
Description: Bilateral symmetric nervous systems have special midline structures that establish a partition between the two mirror image halves. Some axons project toward and across the midline in response to long-range chemoattractants emanating from the midline. The product of this gene is a member of the immunoglobulin gene superfamily and encodes an integral membrane protein that functions in axon guidance and neuronal precursor cell migration. This receptor is activated by SLIT-family proteins, resulting in a repulsive effect on glioma cell guidance in the developing brain. A related gene is located at an adjacent region on chromosome 3. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-ROBO1 antibody
STJ117508 100 µl
EUR 277
Description: Bilateral symmetric nervous systems have special midline structures that establish a partition between the two mirror image halves. Some axons project toward and across the midline in response to long-range chemoattractants emanating from the midline. The product of this gene is a member of the immunoglobulin gene superfamily and encodes an integral membrane protein that functions in axon guidance and neuronal precursor cell migration. This receptor is activated by SLIT-family proteins, resulting in a repulsive effect on glioma cell guidance in the developing brain. A related gene is located at an adjacent region on chromosome 3. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-ROBO1 antibody
STJ191349 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ROBO1

Polyclonal Goat Anti-ROBO1 / DUTT1 (Internal) Antibody
APG00285G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-ROBO1 / DUTT1 (Internal) . This antibody is tested and proven to work in the following applications:

ROBO1 siRNA
20-abx904630
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ROBO1 siRNA
20-abx931831
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ROBO1 siRNA
20-abx931832
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-Robo1
YF-PA24590 50 ul
EUR 334
Description: Mouse polyclonal to Robo1

ROBO1 Antibody, HRP conjugated
1-CSB-PA896760LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ROBO1. Recognizes ROBO1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ROBO1 Antibody, FITC conjugated
1-CSB-PA896760LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ROBO1. Recognizes ROBO1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ROBO1 Antibody, Biotin conjugated
1-CSB-PA896760LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ROBO1. Recognizes ROBO1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-ROBO1/DUTT1 Antibody
A01530 100ug/200ul
EUR 397
Description: Goat Polyclonal ROBO1/DUTT1 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

anti- ROBO1-Specific antibody
FNab07372 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: roundabout, axon guidance receptor, homolog 1(Drosophila)
  • Uniprot ID: Q9Y6N7
  • Research Area: Neuroscience, Immunology, Cardiovascular, Developmental biology
Description: Antibody raised against ROBO1-Specific

Anti-ROBO1-Specific antibody
PAab07372 100 ug
EUR 386

ROBO1 cloning plasmid
CSB-CL896760HU-10ug 10ug
EUR 1876
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4824
  • Sequence: ATGATTGCGGAGCCCGCTCACTTTTACCTGTTTGGATTAATATGTCTCTGTTCAGGCTCCCGTCTTCGTCAGGAAGATTTTCCACCTCGCATTGTTGAACACCCTTCAGACCTGATTGTCTCAAAAGGAGAACCTGCAACTTTGAACTGCAAAGCTGAAGGCCGCCCCACACCCA
  • Show more
Description: A cloning plasmid for the ROBO1 gene.

ROBO1 Blocking Peptide
DF9877-BP 1mg
EUR 195

ROBO1 Blocking Peptide
20-abx161212
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Anti-Robo1 (2G6)
YF-MA10787 100 ug
EUR 363
Description: Mouse monoclonal to Robo1

Anti-Robo1 (1F8)
YF-MA15223 100 ug
EUR 363
Description: Mouse monoclonal to Robo1

Anti-ROBO1 / DUTT1 (Internal) antibody
STJ70835 100 µg
EUR 359

Anti-Robo1 / DUTT1 (mouse) antibody
STJ71019 100 µg
EUR 359

Roundabout Guidance Receptor 1 (ROBO1) Antibody
20-abx218334
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Roundabout Guidance Receptor 1 (ROBO1) Antibody
20-abx115338
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Roundabout Guidance Receptor 1 (ROBO1) Antibody
20-abx121212
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Roundabout Guidance Receptor 1 (ROBO1) Antibody
20-abx124241
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Roundabout Guidance Receptor 1 (ROBO1) Antibody
abx340092-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Roundabout Guidance Receptor 1 (ROBO1) Antibody
20-abx316687
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Roundabout Guidance Receptor 1 (ROBO1) Antibody
abx430381-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Roundabout Guidance Receptor 1 (Robo1) Antibody
abx430382-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

ROBO1 ELISA KIT|Human
EF002538 96 Tests
EUR 689

Mouse ROBO1 shRNA Plasmid
20-abx972473
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat ROBO1 shRNA Plasmid
20-abx985932
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ROBO1 shRNA Plasmid
20-abx954100
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Roundabout Guidance Receptor 1 (ROBO1) Antibody (HRP)
20-abx316688
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Roundabout Guidance Receptor 1 (ROBO1) Antibody (FITC)
20-abx316689
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Roundabout Guidance Receptor 1 (ROBO1) Antibody (Biotin)
20-abx316690
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Monoclonal ROBO1 Antibody (monoclonal) (M01), Clone: 2G6
AMM04033G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human ROBO1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2G6. This antibody is applicable in WB, E

Mouse Roundabout homolog 1 (Robo1)
1-CSB-MP020054MO
  • EUR 293.00
  • EUR 963.00
  • EUR 409.00
  • EUR 717.00
  • 100ug
  • 1MG
  • 200ug
  • 500ug
  • MW: 84 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Roundabout homolog 1(Robo1) ,partial expressed in Mammalian cell

Mouse Roundabout homolog 1 (Robo1)
1-CSB-YP020054MO
  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 82 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Roundabout homolog 1(Robo1),partial expressed in Yeast

Human ROBO1 PicoKine ELISA Kit
EK1755 96 wells
EUR 425
Description: For quantitative detection of human ROBO1 in cell culture supernates, serum and plasma (heparin).

Robo1 ORF Vector (Rat) (pORF)
ORF075499 1.0 ug DNA
EUR 2080

ROBO1 ORF Vector (Human) (pORF)
ORF014327 1.0 ug DNA
EUR 354

Robo1 ORF Vector (Mouse) (pORF)
ORF056258 1.0 ug DNA
EUR 1572

pCR-BluntII-TOPO-ROBO1 Plasmid
PVTB00489 2 ug
EUR 356

Robo1 sgRNA CRISPR Lentivector set (Rat)
K6888401 3 x 1.0 ug
EUR 339

Robo1 sgRNA CRISPR Lentivector set (Mouse)
K4643901 3 x 1.0 ug
EUR 339

ROBO1 sgRNA CRISPR Lentivector set (Human)
K1867601 3 x 1.0 ug
EUR 339

Human Roundabout homolog 1(ROBO1) ELISA kit
CSB-EL020054HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Roundabout homolog 1 (ROBO1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Roundabout homolog 1(ROBO1) ELISA kit
1-CSB-EL020054HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Roundabout homolog 1(ROBO1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Robo1/ Roundabout homolog 1 ELISA Kit
E0848Ra 1 Kit
EUR 646

Mouse Robo1/ Roundabout homolog 1 ELISA Kit
E1276Mo 1 Kit
EUR 632

Human ROBO1/ Roundabout homolog 1 ELISA Kit
E2165Hu 1 Kit
EUR 605

Human Roundabout homolog 1, ROBO1 ELISA KIT
ELI-53163h 96 Tests
EUR 824

Rat Roundabout homolog 1, Robo1 ELISA KIT
ELI-42660r 96 Tests
EUR 886

Mouse Roundabout homolog 1 (ROBO1) ELISA Kit
abx555892-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Roundabout homolog 1 (ROBO1) ELISA Kit
abx556264-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Roundabout homolog 1 (ROBO1) ELISA Kit
abx556329-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Roundabout homolog 1, Robo1 ELISA KIT
ELI-38645m 96 Tests
EUR 865

Robo1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6888402 1.0 ug DNA
EUR 154

Robo1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6888403 1.0 ug DNA
EUR 154

Robo1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6888404 1.0 ug DNA
EUR 154

Robo1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4643902 1.0 ug DNA
EUR 154

Robo1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4643903 1.0 ug DNA
EUR 154

Robo1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4643904 1.0 ug DNA
EUR 154

ROBO1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1867602 1.0 ug DNA
EUR 154

ROBO1 Rabbit Polyclonal Antibody