ROBO1 Polyclonal Antibody |
ES10191-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ROBO1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ROBO1 Polyclonal Antibody |
ES10191-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ROBO1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ROBO1 Rabbit pAb |
A15313-100ul |
Abclonal |
100 ul |
EUR 308 |
ROBO1 Rabbit pAb |
A15313-200ul |
Abclonal |
200 ul |
EUR 459 |
ROBO1 Rabbit pAb |
A15313-20ul |
Abclonal |
20 ul |
EUR 183 |
ROBO1 Rabbit pAb |
A15313-50ul |
Abclonal |
50 ul |
EUR 223 |
ROBO1 Rabbit pAb |
A9412-100ul |
Abclonal |
100 ul |
EUR 308 |
ROBO1 Rabbit pAb |
A9412-200ul |
Abclonal |
200 ul |
EUR 459 |
ROBO1 Rabbit pAb |
A9412-20ul |
Abclonal |
20 ul |
EUR 183 |
ROBO1 Rabbit pAb |
A9412-50ul |
Abclonal |
50 ul |
Ask for price |
ROBO1 Rabbit pAb |
A19506-100ul |
Abclonal |
100 ul |
Ask for price |
ROBO1 Rabbit pAb |
A19506-200ul |
Abclonal |
200 ul |
Ask for price |
ROBO1 Rabbit pAb |
A19506-20ul |
Abclonal |
20 ul |
Ask for price |
ROBO1 Rabbit pAb |
A19506-50ul |
Abclonal |
50 ul |
EUR 308 |
Polyclonal ROBO1 Antibody (Internal) |
APG01042G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ROBO1 (Internal). This antibody is tested and proven to work in the following applications: |
Polyclonal ROBO1 Antibody (Internal) |
APG01234G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ROBO1 (Internal). This antibody is tested and proven to work in the following applications: |
ROBO1 antibody |
70R-21676 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal ROBO1 antibody |
ROBO1 Antibody |
46218-100ul |
SAB |
100ul |
EUR 252 |
ROBO1 Antibody |
46218-50ul |
SAB |
50ul |
EUR 187 |
ROBO1 Antibody |
1-CSB-PA896760LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ROBO1. Recognizes ROBO1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200 |
ROBO1 Antibody |
DF9877 |
Affbiotech |
200ul |
EUR 304 |
Description: ROBO1 Antibody detects endogenous levels of total ROBO1. |
ROBO1 Antibody |
1-CSB-PA020054GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against ROBO1. Recognizes ROBO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Polyclonal ROBO1 Antibody (aa1632-1644) |
APR02181G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ROBO1 (aa1632-1644). This antibody is tested and proven to work in the following applications: |
Anti-ROBO1 Antibody |
A01530-2 |
BosterBio |
100ug/vial |
EUR 294 |
ROBO1 Conjugated Antibody |
C46218 |
SAB |
100ul |
EUR 397 |
ROBO1-Specific Antibody |
abx237372-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Anti-ROBO1 antibody |
STJ11100699 |
St John's Laboratory |
50 µl |
EUR 287 |
Description: Bilateral symmetric nervous systems have special midline structures that establish a partition between the two mirror image halves. Some axons project toward and across the midline in response to long-range chemoattractants emanating from the midline. The product of this gene is a member of the immunoglobulin gene superfamily and encodes an integral membrane protein that functions in axon guidance and neuronal precursor cell migration. This receptor is activated by SLIT-family proteins, resulting in a repulsive effect on glioma cell guidance in the developing brain. A related gene is located at an adjacent region on chromosome 3. Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-ROBO1 antibody |
STJ111690 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Bilateral symmetric nervous systems have special midline structures that establish a partition between the two mirror image halves. Some axons project toward and across the midline in response to long-range chemoattractants emanating from the midline. The product of this gene is a member of the immunoglobulin gene superfamily and encodes an integral membrane protein that functions in axon guidance and neuronal precursor cell migration. This receptor is activated by SLIT-family proteins, resulting in a repulsive effect on glioma cell guidance in the developing brain. A related gene is located at an adjacent region on chromosome 3. Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-ROBO1 antibody |
STJ117508 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Bilateral symmetric nervous systems have special midline structures that establish a partition between the two mirror image halves. Some axons project toward and across the midline in response to long-range chemoattractants emanating from the midline. The product of this gene is a member of the immunoglobulin gene superfamily and encodes an integral membrane protein that functions in axon guidance and neuronal precursor cell migration. This receptor is activated by SLIT-family proteins, resulting in a repulsive effect on glioma cell guidance in the developing brain. A related gene is located at an adjacent region on chromosome 3. Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-ROBO1 antibody |
STJ191349 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to ROBO1 |
Polyclonal Goat Anti-ROBO1 / DUTT1 (Internal) Antibody |
APG00285G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-ROBO1 / DUTT1 (Internal) . This antibody is tested and proven to work in the following applications: |
ROBO1 siRNA |
20-abx904630 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ROBO1 siRNA |
20-abx931831 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ROBO1 siRNA |
20-abx931832 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-Robo1 |
YF-PA24590 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to Robo1 |
ROBO1 Antibody, HRP conjugated |
1-CSB-PA896760LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ROBO1. Recognizes ROBO1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
ROBO1 Antibody, FITC conjugated |
1-CSB-PA896760LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ROBO1. Recognizes ROBO1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
ROBO1 Antibody, Biotin conjugated |
1-CSB-PA896760LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ROBO1. Recognizes ROBO1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Anti-ROBO1/DUTT1 Antibody |
A01530 |
BosterBio |
100ug/200ul |
EUR 397 |
Description: Goat Polyclonal ROBO1/DUTT1 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat. |
anti- ROBO1-Specific antibody |
FNab07372 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:2000
- Immunogen: roundabout, axon guidance receptor, homolog 1(Drosophila)
- Uniprot ID: Q9Y6N7
- Research Area: Neuroscience, Immunology, Cardiovascular, Developmental biology
|
Description: Antibody raised against ROBO1-Specific |
ROBO1 cloning plasmid |
CSB-CL896760HU-10ug |
Cusabio |
10ug |
EUR 1876 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 4824
- Sequence: ATGATTGCGGAGCCCGCTCACTTTTACCTGTTTGGATTAATATGTCTCTGTTCAGGCTCCCGTCTTCGTCAGGAAGATTTTCCACCTCGCATTGTTGAACACCCTTCAGACCTGATTGTCTCAAAAGGAGAACCTGCAACTTTGAACTGCAAAGCTGAAGGCCGCCCCACACCCA
- Show more
|
Description: A cloning plasmid for the ROBO1 gene. |
ROBO1 Blocking Peptide |
DF9877-BP |
Affbiotech |
1mg |
EUR 195 |
ROBO1 Blocking Peptide |
20-abx161212 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Anti-Robo1 (2G6) |
YF-MA10787 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Robo1 |
Anti-Robo1 (1F8) |
YF-MA15223 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Robo1 |
Roundabout Guidance Receptor 1 (ROBO1) Antibody |
20-abx218334 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Roundabout Guidance Receptor 1 (ROBO1) Antibody |
20-abx115338 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Roundabout Guidance Receptor 1 (ROBO1) Antibody |
20-abx121212 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Roundabout Guidance Receptor 1 (ROBO1) Antibody |
20-abx124241 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Roundabout Guidance Receptor 1 (ROBO1) Antibody |
abx340092-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Roundabout Guidance Receptor 1 (ROBO1) Antibody |
20-abx316687 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Roundabout Guidance Receptor 1 (ROBO1) Antibody |
abx430381-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Roundabout Guidance Receptor 1 (Robo1) Antibody |
abx430382-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Mouse ROBO1 shRNA Plasmid |
20-abx972473 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat ROBO1 shRNA Plasmid |
20-abx985932 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human ROBO1 shRNA Plasmid |
20-abx954100 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Roundabout Guidance Receptor 1 (ROBO1) Antibody (HRP) |
20-abx316688 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Roundabout Guidance Receptor 1 (ROBO1) Antibody (FITC) |
20-abx316689 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Roundabout Guidance Receptor 1 (ROBO1) Antibody (Biotin) |
20-abx316690 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Monoclonal ROBO1 Antibody (monoclonal) (M01), Clone: 2G6 |
AMM04033G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human ROBO1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2G6. This antibody is applicable in WB, E |
Mouse Roundabout homolog 1 (Robo1) |
1-CSB-MP020054MO |
Cusabio |
-
EUR 293.00
-
EUR 963.00
-
EUR 409.00
-
EUR 717.00
|
|
- MW: 84 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Roundabout homolog 1(Robo1) ,partial expressed in Mammalian cell |
Mouse Roundabout homolog 1 (Robo1) |
1-CSB-YP020054MO |
Cusabio |
-
EUR 586.00
-
EUR 299.00
-
EUR 2172.00
-
EUR 900.00
-
EUR 1442.00
-
EUR 382.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 82 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Roundabout homolog 1(Robo1),partial expressed in Yeast |
Human ROBO1 PicoKine ELISA Kit |
EK1755 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human ROBO1 in cell culture supernates, serum and plasma (heparin). |
Robo1 ORF Vector (Rat) (pORF) |
ORF075499 |
ABM |
1.0 ug DNA |
EUR 2080 |
ROBO1 ORF Vector (Human) (pORF) |
ORF014327 |
ABM |
1.0 ug DNA |
EUR 354 |
Robo1 ORF Vector (Mouse) (pORF) |
ORF056258 |
ABM |
1.0 ug DNA |
EUR 1572 |
Robo1 sgRNA CRISPR Lentivector set (Rat) |
K6888401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Robo1 sgRNA CRISPR Lentivector set (Mouse) |
K4643901 |
ABM |
3 x 1.0 ug |
EUR 339 |
ROBO1 sgRNA CRISPR Lentivector set (Human) |
K1867601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Roundabout homolog 1(ROBO1) ELISA kit |
CSB-EL020054HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Roundabout homolog 1 (ROBO1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Roundabout homolog 1(ROBO1) ELISA kit |
1-CSB-EL020054HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Roundabout homolog 1(ROBO1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Rat Robo1/ Roundabout homolog 1 ELISA Kit |
E0848Ra |
Sunlong |
1 Kit |
EUR 646 |
Mouse Robo1/ Roundabout homolog 1 ELISA Kit |
E1276Mo |
Sunlong |
1 Kit |
EUR 632 |
Human ROBO1/ Roundabout homolog 1 ELISA Kit |
E2165Hu |
Sunlong |
1 Kit |
EUR 605 |
Human Roundabout homolog 1, ROBO1 ELISA KIT |
ELI-53163h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse Roundabout homolog 1 (ROBO1) ELISA Kit |
abx555892-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Roundabout homolog 1 (ROBO1) ELISA Kit |
abx556264-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Roundabout homolog 1 (ROBO1) ELISA Kit |
abx556329-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Roundabout homolog 1, Robo1 ELISA KIT |
ELI-38645m |
Lifescience Market |
96 Tests |
EUR 865 |
Robo1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6888402 |
ABM |
1.0 ug DNA |
EUR 154 |
Robo1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6888403 |
ABM |
1.0 ug DNA |
EUR 154 |
Robo1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6888404 |
ABM |
1.0 ug DNA |
EUR 154 |
Robo1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4643902 |
ABM |
1.0 ug DNA |
EUR 154 |
Robo1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4643903 |
ABM |
1.0 ug DNA |
EUR 154 |
Robo1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4643904 |
ABM |
1.0 ug DNA |
EUR 154 |
ROBO1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1867602 |
ABM |
1.0 ug DNA |
EUR 154 |
ROBO1 Rabbit Polyclonal Antibody