Biocat Net

RPAP3 Rabbit pAb
A9575-100ul	Abclonal	100 ul	EUR 308

RPAP3 Rabbit pAb
A9575-200ul	Abclonal	200 ul	EUR 459

RPAP3 Rabbit pAb
A9575-20ul	Abclonal	20 ul	Ask for price

RPAP3 Rabbit pAb
A9575-50ul	Abclonal	50 ul	Ask for price

RPAP3 Rabbit pAb
A15239-100ul	Abclonal	100 ul	EUR 308

RPAP3 Rabbit pAb
A15239-200ul	Abclonal	200 ul	EUR 459

RPAP3 Rabbit pAb
A15239-20ul	Abclonal	20 ul	EUR 183

RPAP3 Rabbit pAb
A15239-50ul	Abclonal	50 ul	EUR 223

Polyclonal RPAP3 Antibody (Center)
AMM07647G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RPAP3 (Center). This antibody is tested and proven to work in the following applications:

RPAP3 Antibody
35926-100ul	SAB	100ul	EUR 252

RPAP3 Antibody
1-CSB-PA092850	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RPAP3. Recognizes RPAP3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:15-1:50

RPAP3 Antibody
1-CSB-PA961254	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RPAP3. Recognizes RPAP3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

RPAP3 Antibody
DF9875	Affbiotech	200ul	EUR 304
Description: RPAP3 Antibody detects endogenous levels of total RPAP3.

RPAP3 antibody
70R-51102	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal RPAP3 antibody

RPAP3 Antibody
ABD9875	Lifescience Market	100 ug	EUR 438

RPAP3 Conjugated Antibody
C35926	SAB	100ul	EUR 397

anti- RPAP3 antibody
FNab07398	FN Test	100µg	EUR 585
Immunogen: RNA polymerase II associated protein 3 Uniprot ID: Q9H6T3 Gene ID: 79657 Research Area: Metabolism
Description: Antibody raised against RPAP3

Anti-RPAP3 antibody
PAab07398	Lifescience Market	100 ug	EUR 412

Anti-RPAP3 antibody
STJ111750	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes an RNA polymerase II-associated protein. The encoded protein may function in transcriptional regulation and may also regulate apoptosis. Alternatively spliced transcript variants have been described.

Anti-RPAP3 antibody
STJ117433	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes an RNA polymerase II-associated protein. The encoded protein may function in transcriptional regulation and may also regulate apoptosis. Alternatively spliced transcript variants have been described.

Anti-RPAP3 antibody
STJ191347	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to RPAP3

Rpap3/ Rat Rpap3 ELISA Kit
ELI-18352r	Lifescience Market	96 Tests	EUR 886

RPAP3 siRNA
20-abx904641	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPAP3 siRNA
20-abx931882	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPAP3 siRNA
20-abx931883	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPAP3 Blocking Peptide
DF9875-BP	Affbiotech	1mg	EUR 195

RPAP3 Blocking Peptide
20-abx063977	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

RPAP3 cloning plasmid
CSB-CL862030HU-10ug	Cusabio	10ug	EUR 640
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1896 Sequence: atgacttcagcaaataaagcaatcgaattacaactacaagtgaaacaaaatgcagaagaattacaagactttatgcgggatttagaaaactgggaaaaagacattaaacaaaaggatatggaactaagaagacagaatggtgttcctgaagagaatttacctcctattcgaaatg Show more
Description: A cloning plasmid for the RPAP3 gene.

RPAP3 ELISA KIT|Human
EF002557	Lifescience Market	96 Tests	EUR 689

Rat RPAP3 shRNA Plasmid
20-abx989035	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse RPAP3 shRNA Plasmid
20-abx977582	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human RPAP3 shRNA Plasmid
20-abx962461	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RPAP3 Recombinant Protein (Human)
RP026797	ABM	100 ug	Ask for price

RPAP3 Recombinant Protein (Mouse)
RP168893	ABM	100 ug	Ask for price

RPAP3 Recombinant Protein (Rat)
RP226565	ABM	100 ug	Ask for price

Rpap3 ORF Vector (Rat) (pORF)
ORF075523	ABM	1.0 ug DNA	EUR 506

RPAP3 ORF Vector (Human) (pORF)
ORF008933	ABM	1.0 ug DNA	EUR 95

Rpap3 ORF Vector (Mouse) (pORF)
ORF056299	ABM	1.0 ug DNA	EUR 506

Rabbit RNA polymerase II associated protein 3(RPAP3) ELISA kit
E04R0419-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit RNA polymerase II associated protein 3(RPAP3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit RNA polymerase II associated protein 3(RPAP3) ELISA kit
E04R0419-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit RNA polymerase II associated protein 3(RPAP3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit RNA polymerase II associated protein 3(RPAP3) ELISA kit
E04R0419-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit RNA polymerase II associated protein 3(RPAP3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

RNA Polymerase II Associated Protein 3 (RPAP3) Antibody
20-abx008038	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

RNA Polymerase II Associated Protein 3 (RPAP3) Antibody
20-abx213138	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

RNA Polymerase II Associated Protein 3 (RPAP3) Antibody
20-abx124003	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

RNA Polymerase II Associated Protein 3 (RPAP3) Antibody
abx030173-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

RNA Polymerase II Associated Protein 3 (RPAP3) Antibody
abx030173-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

RNA Polymerase II Associated Protein 3 (RPAP3) Antibody
20-abx339172	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

RNA Polymerase II Associated Protein 3 (RPAP3) Antibody
abx237398-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Rpap3 sgRNA CRISPR Lentivector set (Rat)
K7446801	ABM	3 x 1.0 ug	EUR 339

Rpap3 sgRNA CRISPR Lentivector set (Mouse)
K4819301	ABM	3 x 1.0 ug	EUR 339

RPAP3 sgRNA CRISPR Lentivector set (Human)
K1871801	ABM	3 x 1.0 ug	EUR 339

Rpap3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7446802	ABM	1.0 ug DNA	EUR 154

Rpap3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7446803	ABM	1.0 ug DNA	EUR 154

Rpap3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7446804	ABM	1.0 ug DNA	EUR 154

Rpap3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4819302	ABM	1.0 ug DNA	EUR 154

Rpap3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4819303	ABM	1.0 ug DNA	EUR 154

Rpap3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4819304	ABM	1.0 ug DNA	EUR 154

RPAP3 sgRNA CRISPR Lentivector (Human) (Target 1)
K1871802	ABM	1.0 ug DNA	EUR 154

RPAP3 sgRNA CRISPR Lentivector (Human) (Target 2)
K1871803	ABM	1.0 ug DNA	EUR 154

RPAP3 sgRNA CRISPR Lentivector (Human) (Target 3)
K1871804	ABM	1.0 ug DNA	EUR 154

RPAP3 Protein Vector (Rat) (pPB-C-His)
PV302090	ABM	500 ng	EUR 603

RPAP3 Protein Vector (Rat) (pPB-N-His)
PV302091	ABM	500 ng	EUR 603

RPAP3 Protein Vector (Rat) (pPM-C-HA)
PV302092	ABM	500 ng	EUR 603

RPAP3 Protein Vector (Rat) (pPM-C-His)
PV302093	ABM	500 ng	EUR 603

RPAP3 Protein Vector (Human) (pPB-C-His)
PV035729	ABM	500 ng	EUR 329

RPAP3 Protein Vector (Human) (pPB-N-His)
PV035730	ABM	500 ng	EUR 329

RPAP3 Protein Vector (Human) (pPM-C-HA)
PV035731	ABM	500 ng	EUR 329

RPAP3 Protein Vector (Human) (pPM-C-His)
PV035732	ABM	500 ng	EUR 329

RPAP3 Protein Vector (Mouse) (pPB-C-His)
PV225194	ABM	500 ng	EUR 603

RPAP3 Protein Vector (Mouse) (pPB-N-His)
PV225195	ABM	500 ng	EUR 603

RPAP3 Protein Vector (Mouse) (pPM-C-HA)
PV225196	ABM	500 ng	EUR 603

RPAP3 Protein Vector (Mouse) (pPM-C-His)
PV225197	ABM	500 ng	EUR 603

Rpap3 3'UTR Luciferase Stable Cell Line
TU118058	ABM	1.0 ml	Ask for price

Rpap3 3'UTR GFP Stable Cell Line
TU168058	ABM	1.0 ml	Ask for price

Rpap3 3'UTR Luciferase Stable Cell Line
TU219601	ABM	1.0 ml	Ask for price

Rpap3 3'UTR GFP Stable Cell Line
TU269601	ABM	1.0 ml	Ask for price

RPAP3 3'UTR GFP Stable Cell Line
TU070395	ABM	1.0 ml	EUR 1394

RPAP3 3'UTR Luciferase Stable Cell Line
TU020395	ABM	1.0 ml	EUR 1394

RPAP3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV664183	ABM	1.0 ug DNA	EUR 682

RPAP3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV664187	ABM	1.0 ug DNA	EUR 682

RPAP3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV664188	ABM	1.0 ug DNA	EUR 682

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

RPAP3 Rabbit Polyclonal Antibody