RPAP3 Rabbit pAb |
A9575-100ul |
Abclonal |
100 ul |
EUR 308 |
RPAP3 Rabbit pAb |
A9575-200ul |
Abclonal |
200 ul |
EUR 459 |
RPAP3 Rabbit pAb |
A9575-20ul |
Abclonal |
20 ul |
Ask for price |
RPAP3 Rabbit pAb |
A9575-50ul |
Abclonal |
50 ul |
Ask for price |
RPAP3 Rabbit pAb |
A15239-100ul |
Abclonal |
100 ul |
EUR 308 |
RPAP3 Rabbit pAb |
A15239-200ul |
Abclonal |
200 ul |
EUR 459 |
RPAP3 Rabbit pAb |
A15239-20ul |
Abclonal |
20 ul |
EUR 183 |
RPAP3 Rabbit pAb |
A15239-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal RPAP3 Antibody (Center) |
AMM07647G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RPAP3 (Center). This antibody is tested and proven to work in the following applications: |
RPAP3 antibody |
70R-51102 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal RPAP3 antibody |
RPAP3 Antibody |
35926-100ul |
SAB |
100ul |
EUR 252 |
RPAP3 Antibody |
DF9875 |
Affbiotech |
200ul |
EUR 304 |
Description: RPAP3 Antibody detects endogenous levels of total RPAP3. |
RPAP3 Antibody |
1-CSB-PA961254 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against RPAP3. Recognizes RPAP3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50 |
RPAP3 Antibody |
1-CSB-PA092850 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against RPAP3. Recognizes RPAP3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:15-1:50 |
RPAP3 Conjugated Antibody |
C35926 |
SAB |
100ul |
EUR 397 |
anti- RPAP3 antibody |
FNab07398 |
FN Test |
100µg |
EUR 585 |
- Immunogen: RNA polymerase II associated protein 3
- Uniprot ID: Q9H6T3
- Gene ID: 79657
- Research Area: Metabolism
|
Description: Antibody raised against RPAP3 |
Anti-RPAP3 antibody |
STJ111750 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes an RNA polymerase II-associated protein. The encoded protein may function in transcriptional regulation and may also regulate apoptosis. Alternatively spliced transcript variants have been described. |
Anti-RPAP3 antibody |
STJ117433 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes an RNA polymerase II-associated protein. The encoded protein may function in transcriptional regulation and may also regulate apoptosis. Alternatively spliced transcript variants have been described. |
Anti-RPAP3 antibody |
STJ191347 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to RPAP3 |
RPAP3 siRNA |
20-abx904641 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RPAP3 siRNA |
20-abx931882 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RPAP3 siRNA |
20-abx931883 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RPAP3 Blocking Peptide |
20-abx063977 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RPAP3 cloning plasmid |
CSB-CL862030HU-10ug |
Cusabio |
10ug |
EUR 640 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1896
- Sequence: atgacttcagcaaataaagcaatcgaattacaactacaagtgaaacaaaatgcagaagaattacaagactttatgcgggatttagaaaactgggaaaaagacattaaacaaaaggatatggaactaagaagacagaatggtgttcctgaagagaatttacctcctattcgaaatg
- Show more
|
Description: A cloning plasmid for the RPAP3 gene. |
RPAP3 Blocking Peptide |
DF9875-BP |
Affbiotech |
1mg |
EUR 195 |
Mouse RPAP3 shRNA Plasmid |
20-abx977582 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat RPAP3 shRNA Plasmid |
20-abx989035 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human RPAP3 shRNA Plasmid |
20-abx962461 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
RPAP3 Recombinant Protein (Human) |
RP026797 |
ABM |
100 ug |
Ask for price |
RPAP3 Recombinant Protein (Rat) |
RP226565 |
ABM |
100 ug |
Ask for price |
RPAP3 Recombinant Protein (Mouse) |
RP168893 |
ABM |
100 ug |
Ask for price |
RPAP3 ORF Vector (Human) (pORF) |
ORF008933 |
ABM |
1.0 ug DNA |
EUR 95 |
Rpap3 ORF Vector (Mouse) (pORF) |
ORF056299 |
ABM |
1.0 ug DNA |
EUR 506 |
Rpap3 ORF Vector (Rat) (pORF) |
ORF075523 |
ABM |
1.0 ug DNA |
EUR 506 |
Rabbit RNA polymerase II associated protein 3(RPAP3) ELISA kit |
E04R0419-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit RNA polymerase II associated protein 3(RPAP3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit RNA polymerase II associated protein 3(RPAP3) ELISA kit |
E04R0419-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit RNA polymerase II associated protein 3(RPAP3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit RNA polymerase II associated protein 3(RPAP3) ELISA kit |
E04R0419-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit RNA polymerase II associated protein 3(RPAP3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
RNA Polymerase II Associated Protein 3 (RPAP3) Antibody |
20-abx124003 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RNA Polymerase II Associated Protein 3 (RPAP3) Antibody |
20-abx008038 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
RNA Polymerase II Associated Protein 3 (RPAP3) Antibody |
abx030173-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
RNA Polymerase II Associated Protein 3 (RPAP3) Antibody |
abx030173-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
RNA Polymerase II Associated Protein 3 (RPAP3) Antibody |
20-abx339172 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RNA Polymerase II Associated Protein 3 (RPAP3) Antibody |
abx237398-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
RNA Polymerase II Associated Protein 3 (RPAP3) Antibody |
20-abx213138 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RPAP3 sgRNA CRISPR Lentivector set (Human) |
K1871801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rpap3 sgRNA CRISPR Lentivector set (Rat) |
K7446801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rpap3 sgRNA CRISPR Lentivector set (Mouse) |
K4819301 |
ABM |
3 x 1.0 ug |
EUR 339 |
RPAP3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1871802 |
ABM |
1.0 ug DNA |
EUR 154 |
RPAP3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1871803 |
ABM |
1.0 ug DNA |
EUR 154 |
RPAP3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1871804 |
ABM |
1.0 ug DNA |
EUR 154 |
Rpap3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7446802 |
ABM |
1.0 ug DNA |
EUR 154 |
Rpap3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7446803 |
ABM |
1.0 ug DNA |
EUR 154 |
Rpap3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7446804 |
ABM |
1.0 ug DNA |
EUR 154 |
Rpap3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4819302 |
ABM |
1.0 ug DNA |
EUR 154 |
Rpap3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4819303 |
ABM |
1.0 ug DNA |
EUR 154 |
Rpap3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4819304 |
ABM |
1.0 ug DNA |
EUR 154 |
RPAP3 Protein Vector (Human) (pPB-C-His) |
PV035729 |
ABM |
500 ng |
EUR 329 |
RPAP3 Protein Vector (Human) (pPB-N-His) |
PV035730 |
ABM |
500 ng |
EUR 329 |
RPAP3 Protein Vector (Human) (pPM-C-HA) |
PV035731 |
ABM |
500 ng |
EUR 329 |
RPAP3 Protein Vector (Human) (pPM-C-His) |
PV035732 |
ABM |
500 ng |
EUR 329 |
RPAP3 Protein Vector (Rat) (pPB-C-His) |
PV302090 |
ABM |
500 ng |
EUR 603 |
RPAP3 Protein Vector (Rat) (pPB-N-His) |
PV302091 |
ABM |
500 ng |
EUR 603 |
RPAP3 Protein Vector (Rat) (pPM-C-HA) |
PV302092 |
ABM |
500 ng |
EUR 603 |
RPAP3 Protein Vector (Rat) (pPM-C-His) |
PV302093 |
ABM |
500 ng |
EUR 603 |
RPAP3 Protein Vector (Mouse) (pPB-C-His) |
PV225194 |
ABM |
500 ng |
EUR 603 |
RPAP3 Protein Vector (Mouse) (pPB-N-His) |
PV225195 |
ABM |
500 ng |
EUR 603 |
RPAP3 Protein Vector (Mouse) (pPM-C-HA) |
PV225196 |
ABM |
500 ng |
EUR 603 |
RPAP3 Protein Vector (Mouse) (pPM-C-His) |
PV225197 |
ABM |
500 ng |
EUR 603 |
Rpap3 3'UTR GFP Stable Cell Line |
TU168058 |
ABM |
1.0 ml |
Ask for price |
RPAP3 3'UTR Luciferase Stable Cell Line |
TU020395 |
ABM |
1.0 ml |
EUR 1394 |
Rpap3 3'UTR Luciferase Stable Cell Line |
TU118058 |
ABM |
1.0 ml |
Ask for price |
RPAP3 3'UTR GFP Stable Cell Line |
TU070395 |
ABM |
1.0 ml |
EUR 1394 |
Rpap3 3'UTR Luciferase Stable Cell Line |
TU219601 |
ABM |
1.0 ml |
Ask for price |
Rpap3 3'UTR GFP Stable Cell Line |
TU269601 |
ABM |
1.0 ml |
Ask for price |
RPAP3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV664183 |
ABM |
1.0 ug DNA |
EUR 682 |
RPAP3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV664187 |
ABM |
1.0 ug DNA |
EUR 682 |
RPAP3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV664188 |
ABM |
1.0 ug DNA |
EUR 682 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
RPAP3 Rabbit Polyclonal Antibody