RPAP3 Rabbit Polyclonal Antibody

RPAP3 Rabbit pAb

A9575-100ul 100 ul
EUR 308

RPAP3 Rabbit pAb

A9575-200ul 200 ul
EUR 459

RPAP3 Rabbit pAb

A9575-20ul 20 ul Ask for price

RPAP3 Rabbit pAb

A9575-50ul 50 ul Ask for price

RPAP3 Rabbit pAb

A15239-100ul 100 ul
EUR 308

RPAP3 Rabbit pAb

A15239-200ul 200 ul
EUR 459

RPAP3 Rabbit pAb

A15239-20ul 20 ul
EUR 183

RPAP3 Rabbit pAb

A15239-50ul 50 ul
EUR 223

Polyclonal RPAP3 Antibody (Center)

AMM07647G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RPAP3 (Center). This antibody is tested and proven to work in the following applications:

RPAP3 Antibody

35926-100ul 100ul
EUR 252

RPAP3 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RPAP3. Recognizes RPAP3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:15-1:50

RPAP3 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RPAP3. Recognizes RPAP3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

RPAP3 Antibody

DF9875 200ul
EUR 304
Description: RPAP3 Antibody detects endogenous levels of total RPAP3.

RPAP3 antibody

70R-51102 100 ul
EUR 244
Description: Purified Polyclonal RPAP3 antibody

RPAP3 Antibody

ABD9875 100 ug
EUR 438

RPAP3 Conjugated Antibody

C35926 100ul
EUR 397

anti- RPAP3 antibody

FNab07398 100µg
EUR 585
  • Immunogen: RNA polymerase II associated protein 3
  • Uniprot ID: Q9H6T3
  • Gene ID: 79657
  • Research Area: Metabolism
Description: Antibody raised against RPAP3

Anti-RPAP3 antibody

PAab07398 100 ug
EUR 412

Anti-RPAP3 antibody

STJ111750 100 µl
EUR 277
Description: This gene encodes an RNA polymerase II-associated protein. The encoded protein may function in transcriptional regulation and may also regulate apoptosis. Alternatively spliced transcript variants have been described.

Anti-RPAP3 antibody

STJ117433 100 µl
EUR 277
Description: This gene encodes an RNA polymerase II-associated protein. The encoded protein may function in transcriptional regulation and may also regulate apoptosis. Alternatively spliced transcript variants have been described.

Anti-RPAP3 antibody

STJ191347 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RPAP3

Rpap3/ Rat Rpap3 ELISA Kit

ELI-18352r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPAP3 Blocking Peptide

DF9875-BP 1mg
EUR 195

RPAP3 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RPAP3 cloning plasmid

CSB-CL862030HU-10ug 10ug
EUR 640
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1896
  • Sequence: atgacttcagcaaataaagcaatcgaattacaactacaagtgaaacaaaatgcagaagaattacaagactttatgcgggatttagaaaactgggaaaaagacattaaacaaaaggatatggaactaagaagacagaatggtgttcctgaagagaatttacctcctattcgaaatg
  • Show more
Description: A cloning plasmid for the RPAP3 gene.


EF002557 96 Tests
EUR 689

Rat RPAP3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RPAP3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RPAP3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPAP3 Recombinant Protein (Human)

RP026797 100 ug Ask for price

RPAP3 Recombinant Protein (Mouse)

RP168893 100 ug Ask for price

RPAP3 Recombinant Protein (Rat)

RP226565 100 ug Ask for price

Rpap3 ORF Vector (Rat) (pORF)

ORF075523 1.0 ug DNA
EUR 506

RPAP3 ORF Vector (Human) (pORF)

ORF008933 1.0 ug DNA
EUR 95

Rpap3 ORF Vector (Mouse) (pORF)

ORF056299 1.0 ug DNA
EUR 506

Rabbit RNA polymerase II associated protein 3(RPAP3) ELISA kit

E04R0419-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit RNA polymerase II associated protein 3(RPAP3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit RNA polymerase II associated protein 3(RPAP3) ELISA kit

E04R0419-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit RNA polymerase II associated protein 3(RPAP3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit RNA polymerase II associated protein 3(RPAP3) ELISA kit

E04R0419-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit RNA polymerase II associated protein 3(RPAP3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

RNA Polymerase II Associated Protein 3 (RPAP3) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

RNA Polymerase II Associated Protein 3 (RPAP3) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RNA Polymerase II Associated Protein 3 (RPAP3) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

RNA Polymerase II Associated Protein 3 (RPAP3) Antibody

abx030173-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

RNA Polymerase II Associated Protein 3 (RPAP3) Antibody

abx030173-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

RNA Polymerase II Associated Protein 3 (RPAP3) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RNA Polymerase II Associated Protein 3 (RPAP3) Antibody

abx237398-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Rpap3 sgRNA CRISPR Lentivector set (Rat)

K7446801 3 x 1.0 ug
EUR 339

Rpap3 sgRNA CRISPR Lentivector set (Mouse)

K4819301 3 x 1.0 ug
EUR 339

RPAP3 sgRNA CRISPR Lentivector set (Human)

K1871801 3 x 1.0 ug
EUR 339

Rpap3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7446802 1.0 ug DNA
EUR 154

Rpap3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7446803 1.0 ug DNA
EUR 154

Rpap3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7446804 1.0 ug DNA
EUR 154

Rpap3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4819302 1.0 ug DNA
EUR 154

Rpap3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4819303 1.0 ug DNA
EUR 154

Rpap3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4819304 1.0 ug DNA
EUR 154

RPAP3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1871802 1.0 ug DNA
EUR 154

RPAP3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1871803 1.0 ug DNA
EUR 154

RPAP3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1871804 1.0 ug DNA
EUR 154

RPAP3 Protein Vector (Rat) (pPB-C-His)

PV302090 500 ng
EUR 603

RPAP3 Protein Vector (Rat) (pPB-N-His)

PV302091 500 ng
EUR 603

RPAP3 Protein Vector (Rat) (pPM-C-HA)

PV302092 500 ng
EUR 603

RPAP3 Protein Vector (Rat) (pPM-C-His)

PV302093 500 ng
EUR 603

RPAP3 Protein Vector (Human) (pPB-C-His)

PV035729 500 ng
EUR 329

RPAP3 Protein Vector (Human) (pPB-N-His)

PV035730 500 ng
EUR 329

RPAP3 Protein Vector (Human) (pPM-C-HA)

PV035731 500 ng
EUR 329

RPAP3 Protein Vector (Human) (pPM-C-His)

PV035732 500 ng
EUR 329

RPAP3 Protein Vector (Mouse) (pPB-C-His)

PV225194 500 ng
EUR 603

RPAP3 Protein Vector (Mouse) (pPB-N-His)

PV225195 500 ng
EUR 603

RPAP3 Protein Vector (Mouse) (pPM-C-HA)

PV225196 500 ng
EUR 603

RPAP3 Protein Vector (Mouse) (pPM-C-His)

PV225197 500 ng
EUR 603

Rpap3 3'UTR Luciferase Stable Cell Line

TU118058 1.0 ml Ask for price

Rpap3 3'UTR GFP Stable Cell Line

TU168058 1.0 ml Ask for price

Rpap3 3'UTR Luciferase Stable Cell Line

TU219601 1.0 ml Ask for price

Rpap3 3'UTR GFP Stable Cell Line

TU269601 1.0 ml Ask for price

RPAP3 3'UTR GFP Stable Cell Line

TU070395 1.0 ml
EUR 1394

RPAP3 3'UTR Luciferase Stable Cell Line

TU020395 1.0 ml
EUR 1394

RPAP3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV664183 1.0 ug DNA
EUR 682

RPAP3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV664187 1.0 ug DNA
EUR 682

RPAP3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV664188 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

RPAP3 Rabbit Polyclonal Antibody