RRBP1 Rabbit Polyclonal Antibody

RRBP1 Rabbit pAb
A12239-100ul 100 ul
EUR 308

RRBP1 Rabbit pAb
A12239-200ul 200 ul
EUR 459

RRBP1 Rabbit pAb
A12239-20ul 20 ul
EUR 183

RRBP1 Rabbit pAb
A12239-50ul 50 ul
EUR 223

RRBP1 antibody
70R-6733 50 ug
EUR 467
Description: Rabbit polyclonal RRBP1 antibody

RRBP1 Antibody
40086-100ul 100ul
EUR 252

RRBP1 Antibody
1-CSB-PA083779
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RRBP1. Recognizes RRBP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

RRBP1 Conjugated Antibody
C40086 100ul
EUR 397

anti- RRBP1 antibody
FNab07491 100µg
EUR 548.75
  • Immunogen: ribosome binding protein 1 homolog 180kDa(dog)
  • Uniprot ID: Q9P2E9
  • Gene ID: 6238
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against RRBP1

Anti-RRBP1 Antibody
A07074-1 100ug/vial
EUR 334

Anti-RRBP1 Antibody
A1880-100
EUR 403

Anti-RRBP1 antibody
PAab07491 100 ug
EUR 386

Anti-RRBP1 antibody
STJ114130 100 µl
EUR 277
Description: This gene encodes a ribosome-binding protein of the endoplasmic reticulum (ER) membrane. Studies suggest that this gene plays a role in ER proliferation, secretory pathways and secretory cell differentiation, and mediation of ER-microtubule interactions. Alternative splicing has been observed and protein isoforms are characterized by regions of N-terminal decapeptide and C-terminal heptad repeats. Splicing of the tandem repeats results in variations in ribosome-binding affinity and secretory function. The full-length nature of variants which differ in repeat length has not been determined. Pseudogenes of this gene have been identified on chromosomes 3 and 7, and RRBP1 has been excluded as a candidate gene in the cause of Alagille syndrome, the result of a mutation in a nearby gene on chromosome 20p12.

Anti-RRBP1 antibody
STJ191343 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RRBP1

RRBP1 siRNA
20-abx932146
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RRBP1 siRNA
20-abx932147
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human RRBP1 Protein
20-abx650869
  • EUR 759.00
  • EUR 300.00
  • EUR 2388.00
  • EUR 913.00
  • EUR 537.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

RRBP1 Blocking Peptide
33R-9024 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RRBP1 antibody, catalog no. 70R-6733

RRBP1 cloning plasmid
CSB-CL879068HU-10ug 10ug
EUR 895
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2805
  • Sequence: ATGGTGGTGGTGCCCCCAGTGGGTGCCAAGGGCAACACACCAGCCACTGGCACTACTCAGGGCAAAAAGGCGGAGGGGACTCAGAATCAAAGCAAAAAGGCTGAAGGAGCCCCAAACCAGGGCAGAAAGGCAGAGGGAACCCCAAACCAGGGCAAAAAGACAGAGGGAACCCCAA
  • Show more
Description: A cloning plasmid for the RRBP1 gene.

Mouse RRBP1 shRNA Plasmid
20-abx979110
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RRBP1 ELISA Kit
ELA-E10807h 96 Tests
EUR 824

RRBP1 ELISA KIT|Human
EF002799 96 Tests
EUR 689

Canine RRBP1 ELISA KIT
ELI-38689d 96 Tests
EUR 928

Human RRBP1 shRNA Plasmid
20-abx954201
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Ribosome-Binding Protein 1 (RRBP1) Antibody
20-abx126500
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosome-Binding Protein 1 (RRBP1) Antibody
abx030321-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ribosome-Binding Protein 1 (RRBP1) Antibody
abx030321-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ribosome-Binding Protein 1 (RRBP1) Antibody
abx237491-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Ribosome-binding protein 1 (RRBP1) Antibody
20-abx213196
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rrbp1 ORF Vector (Mouse) (pORF)
ORF056455 1.0 ug DNA
EUR 506

Rrbp1 ORF Vector (Mouse) (pORF)
ORF056456 1.0 ug DNA
EUR 1572

RRBP1 ORF Vector (Human) (pORF)
ORF014341 1.0 ug DNA
EUR 354

RRBP1 ELISA Kit (Human) (OKEH02114)
OKEH02114 96 Wells
EUR 662
Description: Description of target: This gene encodes a ribosome-binding protein of the endoplasmic reticulum (ER) membrane. Studies suggest that this gene plays a role in ER proliferation, secretory pathways and secretory cell differentiation, and mediation of ER-microtubule interactions. Alternative splicing has been observed and protein isoforms are characterized by regions of N-terminal decapeptide and C-terminal heptad repeats. Splicing of the tandem repeats results in variations in ribosome-binding affinity and secretory function. The full-length nature of variants which differ in repeat length has not been determined. Pseudogenes of this gene have been identified on chromosomes 3 and 7, and RRBP1 has been excluded as a candidate gene in the cause of Alagille syndrome, the result of a mutation in a nearby gene on chromosome 20p12.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 34 pg/mL

RRBP1 ELISA Kit (Dog) (OKEH07655)
OKEH07655 96 Wells
EUR 1184
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

RRBP1 sgRNA CRISPR Lentivector set (Human)
K2070701 3 x 1.0 ug
EUR 339

Rrbp1 sgRNA CRISPR Lentivector set (Mouse)
K4627501 3 x 1.0 ug
EUR 339

Recombinant Ribosome Binding Protein 1 (RRBP1)
4-RPC770Hu01
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • EUR 660.00
  • EUR 1220.00
  • EUR 430.00
  • EUR 4300.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9P2E9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 21.1kDa
  • Isoelectric Point: 4.7
Description: Recombinant Human Ribosome Binding Protein 1 expressed in: E.coli

RRBP1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2070702 1.0 ug DNA
EUR 154

RRBP1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2070703 1.0 ug DNA
EUR 154

RRBP1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2070704 1.0 ug DNA
EUR 154

Rrbp1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4627502 1.0 ug DNA
EUR 154

Rrbp1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4627503 1.0 ug DNA
EUR 154

Rrbp1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4627504 1.0 ug DNA
EUR 154

RRBP1 Protein Vector (Human) (pPB-C-His)
PV057361 500 ng
EUR 481

RRBP1 Protein Vector (Human) (pPB-N-His)
PV057362 500 ng
EUR 481

RRBP1 Protein Vector (Human) (pPM-C-HA)
PV057363 500 ng
EUR 481

RRBP1 Protein Vector (Human) (pPM-C-His)
PV057364 500 ng
EUR 481

RRBP1 Protein Vector (Mouse) (pPB-C-His)
PV225818 500 ng
EUR 1065

RRBP1 Protein Vector (Mouse) (pPB-N-His)
PV225819 500 ng
EUR 1065

RRBP1 Protein Vector (Mouse) (pPM-C-HA)
PV225820 500 ng
EUR 1065

RRBP1 Protein Vector (Mouse) (pPM-C-His)
PV225821 500 ng
EUR 1065

RRBP1 Protein Vector (Mouse) (pPB-C-His)
PV225822 500 ng
EUR 2483

RRBP1 Protein Vector (Mouse) (pPB-N-His)
PV225823 500 ng
EUR 2483

RRBP1 Protein Vector (Mouse) (pPM-C-HA)
PV225824 500 ng
EUR 2483

RRBP1 Protein Vector (Mouse) (pPM-C-His)
PV225825 500 ng
EUR 2483

Rrbp1 3'UTR GFP Stable Cell Line
TU168190 1.0 ml Ask for price

RRBP1 3'UTR Luciferase Stable Cell Line
TU022388 1.0 ml
EUR 1394

Rrbp1 3'UTR Luciferase Stable Cell Line
TU118190 1.0 ml Ask for price

RRBP1 3'UTR GFP Stable Cell Line
TU072388 1.0 ml
EUR 1394

Rrbp1 3'UTR Luciferase Stable Cell Line
TU219732 1.0 ml Ask for price

Rrbp1 3'UTR GFP Stable Cell Line
TU269732 1.0 ml Ask for price

Dog Ribosome-binding protein 1 (RRBP1) ELISA Kit
abx515078-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Ribosome-binding protein 1 (RRBP1) ELISA Kit
abx515080-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Mouse Rrbp1/ Ribosome-binding protein 1 ELISA Kit
E1673Mo 1 Kit
EUR 632

Human RRBP1/ Ribosome-binding protein 1 ELISA Kit
E2178Hu 1 Kit
EUR 605

Human RRBP1(Ribosome-binding protein 1) ELISA Kit
EH1215 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: Q9P2E9
  • Alias: RRBP1/Ribosome-binding protein 1/Ribosome receptor protein/180 kDa ribosome receptor homolog/RRp
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Human Ribosome- binding protein 1, RRBP1 ELISA KIT
ELI-18387h 96 Tests
EUR 824

Mouse Ribosome- binding protein 1, Rrbp1 ELISA KIT
ELI-15196m 96 Tests
EUR 865

Human Ribosome-binding protein 1 (RRBP1) ELISA Kit
abx250471-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

RRBP1 Rabbit Polyclonal Antibody