RRBP1 Rabbit pAb |
A12239-100ul |
Abclonal |
100 ul |
EUR 308 |
RRBP1 Rabbit pAb |
A12239-200ul |
Abclonal |
200 ul |
EUR 459 |
RRBP1 Rabbit pAb |
A12239-20ul |
Abclonal |
20 ul |
EUR 183 |
RRBP1 Rabbit pAb |
A12239-50ul |
Abclonal |
50 ul |
EUR 223 |
RRBP1 antibody |
70R-6733 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal RRBP1 antibody |
RRBP1 Antibody |
40086-100ul |
SAB |
100ul |
EUR 252 |
RRBP1 Antibody |
1-CSB-PA083779 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against RRBP1. Recognizes RRBP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100 |
RRBP1 Conjugated Antibody |
C40086 |
SAB |
100ul |
EUR 397 |
anti- RRBP1 antibody |
FNab07491 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: ribosome binding protein 1 homolog 180kDa(dog)
- Uniprot ID: Q9P2E9
- Gene ID: 6238
- Research Area: Signal Transduction, Metabolism
|
Description: Antibody raised against RRBP1 |
Anti-RRBP1 Antibody |
A07074-1 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-RRBP1 Antibody |
A1880-100 |
Biovision |
|
EUR 403 |
Anti-RRBP1 antibody |
STJ114130 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a ribosome-binding protein of the endoplasmic reticulum (ER) membrane. Studies suggest that this gene plays a role in ER proliferation, secretory pathways and secretory cell differentiation, and mediation of ER-microtubule interactions. Alternative splicing has been observed and protein isoforms are characterized by regions of N-terminal decapeptide and C-terminal heptad repeats. Splicing of the tandem repeats results in variations in ribosome-binding affinity and secretory function. The full-length nature of variants which differ in repeat length has not been determined. Pseudogenes of this gene have been identified on chromosomes 3 and 7, and RRBP1 has been excluded as a candidate gene in the cause of Alagille syndrome, the result of a mutation in a nearby gene on chromosome 20p12. |
Anti-RRBP1 antibody |
STJ191343 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to RRBP1 |
RRBP1 siRNA |
20-abx932146 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RRBP1 siRNA |
20-abx932147 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human RRBP1 Protein |
20-abx650869 |
Abbexa |
-
EUR 759.00
-
EUR 300.00
-
EUR 2388.00
-
EUR 913.00
-
EUR 537.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
RRBP1 Blocking Peptide |
33R-9024 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RRBP1 antibody, catalog no. 70R-6733 |
RRBP1 cloning plasmid |
CSB-CL879068HU-10ug |
Cusabio |
10ug |
EUR 895 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2805
- Sequence: ATGGTGGTGGTGCCCCCAGTGGGTGCCAAGGGCAACACACCAGCCACTGGCACTACTCAGGGCAAAAAGGCGGAGGGGACTCAGAATCAAAGCAAAAAGGCTGAAGGAGCCCCAAACCAGGGCAGAAAGGCAGAGGGAACCCCAAACCAGGGCAAAAAGACAGAGGGAACCCCAA
- Show more
|
Description: A cloning plasmid for the RRBP1 gene. |
Mouse RRBP1 shRNA Plasmid |
20-abx979110 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human RRBP1 shRNA Plasmid |
20-abx954201 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Ribosome-Binding Protein 1 (RRBP1) Antibody |
20-abx126500 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Ribosome-Binding Protein 1 (RRBP1) Antibody |
abx030321-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Ribosome-Binding Protein 1 (RRBP1) Antibody |
abx030321-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Ribosome-Binding Protein 1 (RRBP1) Antibody |
abx237491-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Ribosome-binding protein 1 (RRBP1) Antibody |
20-abx213196 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Rrbp1 ORF Vector (Mouse) (pORF) |
ORF056455 |
ABM |
1.0 ug DNA |
EUR 506 |
Rrbp1 ORF Vector (Mouse) (pORF) |
ORF056456 |
ABM |
1.0 ug DNA |
EUR 1572 |
RRBP1 ORF Vector (Human) (pORF) |
ORF014341 |
ABM |
1.0 ug DNA |
EUR 354 |
RRBP1 sgRNA CRISPR Lentivector set (Human) |
K2070701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rrbp1 sgRNA CRISPR Lentivector set (Mouse) |
K4627501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Recombinant Ribosome Binding Protein 1 (RRBP1) |
4-RPC770Hu01 |
Cloud-Clone |
-
EUR 548.00
-
EUR 250.00
-
EUR 1780.00
-
EUR 660.00
-
EUR 1220.00
-
EUR 430.00
-
EUR 4300.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9P2E9
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 21.1kDa
- Isoelectric Point: 4.7
|
Description: Recombinant Human Ribosome Binding Protein 1 expressed in: E.coli |
RRBP1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2070702 |
ABM |
1.0 ug DNA |
EUR 154 |
RRBP1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2070703 |
ABM |
1.0 ug DNA |
EUR 154 |
RRBP1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2070704 |
ABM |
1.0 ug DNA |
EUR 154 |
Rrbp1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4627502 |
ABM |
1.0 ug DNA |
EUR 154 |
Rrbp1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4627503 |
ABM |
1.0 ug DNA |
EUR 154 |
Rrbp1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4627504 |
ABM |
1.0 ug DNA |
EUR 154 |
RRBP1 Protein Vector (Human) (pPB-C-His) |
PV057361 |
ABM |
500 ng |
EUR 481 |
RRBP1 Protein Vector (Human) (pPB-N-His) |
PV057362 |
ABM |
500 ng |
EUR 481 |
RRBP1 Protein Vector (Human) (pPM-C-HA) |
PV057363 |
ABM |
500 ng |
EUR 481 |
RRBP1 Protein Vector (Human) (pPM-C-His) |
PV057364 |
ABM |
500 ng |
EUR 481 |
RRBP1 Protein Vector (Mouse) (pPB-C-His) |
PV225818 |
ABM |
500 ng |
EUR 1065 |
RRBP1 Protein Vector (Mouse) (pPB-N-His) |
PV225819 |
ABM |
500 ng |
EUR 1065 |
RRBP1 Protein Vector (Mouse) (pPM-C-HA) |
PV225820 |
ABM |
500 ng |
EUR 1065 |
RRBP1 Protein Vector (Mouse) (pPM-C-His) |
PV225821 |
ABM |
500 ng |
EUR 1065 |
RRBP1 Protein Vector (Mouse) (pPB-C-His) |
PV225822 |
ABM |
500 ng |
EUR 2483 |
RRBP1 Protein Vector (Mouse) (pPB-N-His) |
PV225823 |
ABM |
500 ng |
EUR 2483 |
RRBP1 Protein Vector (Mouse) (pPM-C-HA) |
PV225824 |
ABM |
500 ng |
EUR 2483 |
RRBP1 Protein Vector (Mouse) (pPM-C-His) |
PV225825 |
ABM |
500 ng |
EUR 2483 |
Rrbp1 3'UTR GFP Stable Cell Line |
TU168190 |
ABM |
1.0 ml |
Ask for price |
RRBP1 3'UTR Luciferase Stable Cell Line |
TU022388 |
ABM |
1.0 ml |
EUR 1394 |
Rrbp1 3'UTR Luciferase Stable Cell Line |
TU118190 |
ABM |
1.0 ml |
Ask for price |
RRBP1 3'UTR GFP Stable Cell Line |
TU072388 |
ABM |
1.0 ml |
EUR 1394 |
Rrbp1 3'UTR Luciferase Stable Cell Line |
TU219732 |
ABM |
1.0 ml |
Ask for price |
Rrbp1 3'UTR GFP Stable Cell Line |
TU269732 |
ABM |
1.0 ml |
Ask for price |
Dog Ribosome-binding protein 1 (RRBP1) ELISA Kit |
abx515078-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Ribosome-binding protein 1 (RRBP1) ELISA Kit |
abx515080-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Mouse Rrbp1/ Ribosome-binding protein 1 ELISA Kit |
E1673Mo |
Sunlong |
1 Kit |
EUR 632 |
Human RRBP1/ Ribosome-binding protein 1 ELISA Kit |
E2178Hu |
Sunlong |
1 Kit |
EUR 605 |
Human RRBP1(Ribosome-binding protein 1) ELISA Kit |
EH1215 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 78-5000 pg/ml
- Uniprot ID: Q9P2E9
- Alias: RRBP1/Ribosome-binding protein 1/Ribosome receptor protein/180 kDa ribosome receptor homolog/RRp
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml |
Human Ribosome- binding protein 1, RRBP1 ELISA KIT |
ELI-18387h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse Ribosome- binding protein 1, Rrbp1 ELISA KIT |
ELI-15196m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Ribosome-binding protein 1 (RRBP1) ELISA Kit |
abx250471-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
RRBP1 Rabbit Polyclonal Antibody