Biocat Net

Amine biocat 3.0

RXRB Rabbit Polyclonal Antibody

RXRB Polyclonal Antibody

ABP60286-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RXRB protein at amino acid sequence of 340-420
  • Applications tips:
Description: A polyclonal antibody for detection of RXRB from Human, Mouse, Rat. This RXRB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RXRB protein at amino acid sequence of 340-420

RXRB Polyclonal Antibody

ABP60286-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RXRB protein at amino acid sequence of 340-420
  • Applications tips:
Description: A polyclonal antibody for detection of RXRB from Human, Mouse, Rat. This RXRB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RXRB protein at amino acid sequence of 340-420

RXRB Polyclonal Antibody

ABP60286-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RXRB protein at amino acid sequence of 340-420
  • Applications tips:
Description: A polyclonal antibody for detection of RXRB from Human, Mouse, Rat. This RXRB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RXRB protein at amino acid sequence of 340-420

RXRB Polyclonal Antibody

ES10158-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RXRB from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RXRB Polyclonal Antibody

ES10158-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RXRB from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RXRB Rabbit pAb

A18119-100ul 100 ul
EUR 308

RXRB Rabbit pAb

A18119-200ul 200 ul
EUR 459

RXRB Rabbit pAb

A18119-20ul 20 ul
EUR 183

RXRB Rabbit pAb

A18119-50ul 50 ul
EUR 223

RXRB Polyclonal Conjugated Antibody

C30315 100ul
EUR 397

RXRB antibody

70R-1919 50 ug
EUR 467
Description: Rabbit polyclonal RXRB antibody raised against the N terminal of RXRB

RXRB antibody

70R-1920 50 ug
EUR 467
Description: Rabbit polyclonal RXRB antibody raised against the N terminal of RXRB

RXRB antibody

70R-12846 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal RXRB antibody

RXRB antibody

70R-20053 50 ul
EUR 435
Description: Rabbit polyclonal RXRB antibody

RXRB antibody

10R-8379 100 ul
EUR 392
Description: Mouse monoclonal RXRB antibody

RXRB Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RXRB. Recognizes RXRB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Rxrb/ Rat Rxrb ELISA Kit

ELI-19900r 96 Tests
EUR 886

anti- RXRB antibody

FNab07544 100µg
EUR 548.75
  • Immunogen: retinoid X receptor, beta
  • Uniprot ID: P28702
  • Gene ID: 6257
  • Research Area: Stem Cells, Signal Transduction, Metabolism
Description: Antibody raised against RXRB

Anti-RXRB antibody

PAab07544 100 ug
EUR 386

Anti-RXRB antibody

STJ11100090 100 µl
EUR 277

Anti-RXRB antibody

STJ191316 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RXRB


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RXRB Blocking Peptide

33R-6089 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RXRB antibody, catalog no. 70R-1919

RXRB Blocking Peptide

33R-7103 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RXRB antibody, catalog no. 70R-1920

RXRB cloning plasmid

CSB-CL020613HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1602
  • Sequence: atgtcttgggccgctcgcccgcccttcctccctcagcggcatgccgcagggcagtgtgggccggtgggggtgcgaaaagaaatgcattgtggggtcgcgtcccggtggcggcggcgacggccctggctggatcccgcagcggcggcggcggcggcggtggcaggcggagaacaac
  • Show more
Description: A cloning plasmid for the RXRB gene.

pDONR223-RXRB Plasmid

PVTB01093-1 2 ug
EUR 356

Monoclonal RXRB Antibody (Hinge Peptide)

AMM02172G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human RXRB (Hinge Peptide). The antibodies are raised in Mouse. This antibody is applicable in WB and IHC-P


ELA-E10636h 96 Tests
EUR 824


ELI-29420d 96 Tests
EUR 928


EF002637 96 Tests
EUR 689

Mouse RXRB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RXRB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RXRB Recombinant Protein (Human)

RP027463 100 ug Ask for price

RXRB Recombinant Protein (Rat)

RP227324 100 ug Ask for price

RXRB Recombinant Protein (Mouse)

RP169748 100 ug Ask for price

RXRB Recombinant Protein (Mouse)

RP169751 100 ug Ask for price

RXRB Recombinant Protein (Mouse)

RP169754 100 ug Ask for price

RXRB Recombinant Protein (Mouse)

RP169757 100 ug Ask for price

Retinoic Acid Receptor RXR-Beta (RXRB) Antibody

abx034505-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Retinoic Acid Receptor RXR-Beta (RXRB) Antibody

abx034505-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Retinoic Acid Receptor RXR-Beta (RXRB) Antibody

abx237544-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Monoclonal RXRB Antibody (monoclonal) (M01), Clone: 3C8

AMM04056G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RXRB (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3C8. This antibody is applicable in WB

Rxrb ORF Vector (Rat) (pORF)

ORF075776 1.0 ug DNA
EUR 506

RXRB ORF Vector (Human) (pORF)

ORF009155 1.0 ug DNA
EUR 95

Rxrb ORF Vector (Mouse) (pORF)

ORF056584 1.0 ug DNA
EUR 506

Rxrb ORF Vector (Mouse) (pORF)

ORF056585 1.0 ug DNA
EUR 506

Rxrb ORF Vector (Mouse) (pORF)

ORF056586 1.0 ug DNA
EUR 506

Rxrb ORF Vector (Mouse) (pORF)

ORF056587 1.0 ug DNA
EUR 506

RXRB ELISA Kit (Dog) (OKEH07629)

OKEH07629 96 Wells
EUR 1184
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

RXRB ELISA Kit (Human) (OKEH02105)

OKEH02105 96 Wells
EUR 662
Description: Description of target: This gene encodes a member of the retinoid X receptor (RXR) family of nuclear receptors which are involved in mediating the effects of retinoic acid (RA). The encoded protein forms homodimers with the retinoic acid, thyroid hormone, and vitamin D receptors, increasing both DNA binding and transcriptional function on their respective response elements. This gene lies within the major histocompatibility complex (MHC) class II region on chromosome 6. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.27 ng/mL

RXRB ELISA Kit (Mouse) (OKEH03597)

OKEH03597 96 Wells
EUR 844
Description: Description of target: Receptor for retinoic acid. Retinoic acid receptors bind as heterodimers to their target response elements in response to their ligands, all-trans or 9-cis retinoic acid, and regulate gene expression in various biological processes. The RAR/RXR heterodimers bind to the retinoic acid response elements (RARE).;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.165 ng/mL

Rxrb sgRNA CRISPR Lentivector set (Rat)

K7235401 3 x 1.0 ug
EUR 339

Rxrb sgRNA CRISPR Lentivector set (Mouse)

K3348601 3 x 1.0 ug
EUR 339

RXRB sgRNA CRISPR Lentivector set (Human)

K2080601 3 x 1.0 ug
EUR 339

Rxrb sgRNA CRISPR Lentivector (Rat) (Target 1)

K7235402 1.0 ug DNA
EUR 154

Rxrb sgRNA CRISPR Lentivector (Rat) (Target 2)

K7235403 1.0 ug DNA
EUR 154

Rxrb sgRNA CRISPR Lentivector (Rat) (Target 3)

K7235404 1.0 ug DNA
EUR 154

Rxrb sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3348602 1.0 ug DNA
EUR 154

Rxrb sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3348603 1.0 ug DNA
EUR 154

Rxrb sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3348604 1.0 ug DNA
EUR 154

RXRB Rabbit Polyclonal Antibody