RXRB Polyclonal Antibody |
ABP60286-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human RXRB protein at amino acid sequence of 340-420
- Applications tips:
|
Description: A polyclonal antibody for detection of RXRB from Human, Mouse, Rat. This RXRB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RXRB protein at amino acid sequence of 340-420 |
RXRB Polyclonal Antibody |
ABP60286-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human RXRB protein at amino acid sequence of 340-420
- Applications tips:
|
Description: A polyclonal antibody for detection of RXRB from Human, Mouse, Rat. This RXRB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RXRB protein at amino acid sequence of 340-420 |
RXRB Polyclonal Antibody |
ABP60286-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RXRB protein at amino acid sequence of 340-420
- Applications tips:
|
Description: A polyclonal antibody for detection of RXRB from Human, Mouse, Rat. This RXRB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RXRB protein at amino acid sequence of 340-420 |
RXRB Polyclonal Antibody |
30315-100ul |
SAB |
100ul |
EUR 252 |
RXRB Polyclonal Antibody |
30315-50ul |
SAB |
50ul |
EUR 187 |
RXRB Rabbit pAb |
A18119-100ul |
Abclonal |
100 ul |
EUR 308 |
RXRB Rabbit pAb |
A18119-200ul |
Abclonal |
200 ul |
EUR 459 |
RXRB Rabbit pAb |
A18119-20ul |
Abclonal |
20 ul |
EUR 183 |
RXRB Rabbit pAb |
A18119-50ul |
Abclonal |
50 ul |
EUR 223 |
RXRB Polyclonal Conjugated Antibody |
C30315 |
SAB |
100ul |
EUR 397 |
RXRB antibody |
10R-8379 |
Fitzgerald |
100 ul |
EUR 392 |
Description: Mouse monoclonal RXRB antibody |
RXRB antibody |
70R-1919 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal RXRB antibody raised against the N terminal of RXRB |
RXRB antibody |
70R-1920 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal RXRB antibody raised against the N terminal of RXRB |
RXRB antibody |
70R-20053 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal RXRB antibody |
RXRB antibody |
70R-12846 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal RXRB antibody |
RXRB Antibody |
1-CSB-PA020613GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against RXRB. Recognizes RXRB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
anti- RXRB antibody |
FNab07544 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: retinoid X receptor, beta
- Uniprot ID: P28702
- Gene ID: 6257
- Research Area: Stem Cells, Signal Transduction, Metabolism
|
Description: Antibody raised against RXRB |
Anti-RXRB antibody |
STJ191316 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to RXRB |
RXRB siRNA |
20-abx932324 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RXRB siRNA |
20-abx932325 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RXRB cloning plasmid |
CSB-CL020613HU-10ug |
Cusabio |
10ug |
EUR 558 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1602
- Sequence: atgtcttgggccgctcgcccgcccttcctccctcagcggcatgccgcagggcagtgtgggccggtgggggtgcgaaaagaaatgcattgtggggtcgcgtcccggtggcggcggcgacggccctggctggatcccgcagcggcggcggcggcggcggtggcaggcggagaacaac
- Show more
|
Description: A cloning plasmid for the RXRB gene. |
RXRB Blocking Peptide |
33R-6089 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RXRB antibody, catalog no. 70R-1919 |
RXRB Blocking Peptide |
33R-7103 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RXRB antibody, catalog no. 70R-1920 |
Monoclonal RXRB Antibody (Hinge Peptide) |
AMM02172G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A Monoclonal antibody against Human RXRB (Hinge Peptide). The antibodies are raised in Mouse. This antibody is applicable in WB and IHC-P |
Human RXRB shRNA Plasmid |
20-abx954213 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse RXRB shRNA Plasmid |
20-abx972540 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
RXRB Recombinant Protein (Human) |
RP027463 |
ABM |
100 ug |
Ask for price |
RXRB Recombinant Protein (Rat) |
RP227324 |
ABM |
100 ug |
Ask for price |
RXRB Recombinant Protein (Mouse) |
RP169748 |
ABM |
100 ug |
Ask for price |
RXRB Recombinant Protein (Mouse) |
RP169751 |
ABM |
100 ug |
Ask for price |
RXRB Recombinant Protein (Mouse) |
RP169754 |
ABM |
100 ug |
Ask for price |
RXRB Recombinant Protein (Mouse) |
RP169757 |
ABM |
100 ug |
Ask for price |
Monoclonal RXRB Antibody (monoclonal) (M01), Clone: 3C8 |
AMM04056G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human RXRB (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3C8. This antibody is applicable in WB |
Retinoic Acid Receptor RXR-Beta (RXRB) Antibody |
abx034505-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Retinoic Acid Receptor RXR-Beta (RXRB) Antibody |
abx034505-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Retinoic Acid Receptor RXR-Beta (RXRB) Antibody |
abx237544-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
RXRB ORF Vector (Human) (pORF) |
ORF009155 |
ABM |
1.0 ug DNA |
EUR 95 |
Rxrb ORF Vector (Mouse) (pORF) |
ORF056584 |
ABM |
1.0 ug DNA |
EUR 506 |
Rxrb ORF Vector (Mouse) (pORF) |
ORF056585 |
ABM |
1.0 ug DNA |
EUR 506 |
Rxrb ORF Vector (Mouse) (pORF) |
ORF056586 |
ABM |
1.0 ug DNA |
EUR 506 |
Rxrb ORF Vector (Mouse) (pORF) |
ORF056587 |
ABM |
1.0 ug DNA |
EUR 506 |
Rxrb ORF Vector (Rat) (pORF) |
ORF075776 |
ABM |
1.0 ug DNA |
EUR 506 |
RXRB sgRNA CRISPR Lentivector set (Human) |
K2080601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rxrb sgRNA CRISPR Lentivector set (Mouse) |
K3348601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rxrb sgRNA CRISPR Lentivector set (Rat) |
K7235401 |
ABM |
3 x 1.0 ug |
EUR 339 |
RXRB sgRNA CRISPR Lentivector (Human) (Target 1) |
K2080602 |
ABM |
1.0 ug DNA |
EUR 154 |
RXRB sgRNA CRISPR Lentivector (Human) (Target 2) |
K2080603 |
ABM |
1.0 ug DNA |
EUR 154 |
RXRB sgRNA CRISPR Lentivector (Human) (Target 3) |
K2080604 |
ABM |
1.0 ug DNA |
EUR 154 |
Rxrb sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3348602 |
ABM |
1.0 ug DNA |
EUR 154 |
Rxrb sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3348603 |
ABM |
1.0 ug DNA |
EUR 154 |
Rxrb sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3348604 |
ABM |
1.0 ug DNA |
EUR 154 |
Rxrb sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7235402 |
ABM |
1.0 ug DNA |
EUR 154 |
Rxrb sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7235403 |
ABM |
1.0 ug DNA |
EUR 154 |
Rxrb sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7235404 |
ABM |
1.0 ug DNA |
EUR 154 |
RXRB Rabbit Polyclonal Antibody