Biocat Net

Amine biocat 3.0

SASH3 Rabbit Polyclonal Antibody

Anti-SASH3 antibody

STJ191412 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SASH3


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SASH3 cloning plasmid

CSB-CL020715HU-10ug 10ug
EUR 430
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1143
  • Sequence: atgctgcgccgcaagccctccaatgccagtgagaaggagcccactcagaagaaaaagctctcccttcagcgctccagcagcttcaaggattttgccaaatccaaacccagctcccccgtggtgagcgagaaggagtttaatctggatgataacattccagaagatgactcaggtg
  • Show more
Description: A cloning plasmid for the SASH3 gene.

Mouse SASH3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF005538 96 Tests
EUR 689

Human SASH3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SASH3 Recombinant Protein (Human)

RP027613 100 ug Ask for price

SASH3 Recombinant Protein (Rat)

RP227492 100 ug Ask for price

SASH3 Recombinant Protein (Mouse)

RP170027 100 ug Ask for price

SASH3 ORF Vector (Human) (pORF)

ORF009205 1.0 ug DNA
EUR 95

Sash3 ORF Vector (Mouse) (pORF)

ORF056677 1.0 ug DNA
EUR 506

Sash3 ORF Vector (Rat) (pORF)

ORF075832 1.0 ug DNA
EUR 506

SASH3 sgRNA CRISPR Lentivector set (Human)

K2090301 3 x 1.0 ug
EUR 339

Sash3 sgRNA CRISPR Lentivector set (Mouse)

K3443601 3 x 1.0 ug
EUR 339

Sash3 sgRNA CRISPR Lentivector set (Rat)

K7446701 3 x 1.0 ug
EUR 339

SASH3 sgRNA CRISPR Lentivector (Human) (Target 1)

K2090302 1.0 ug DNA
EUR 154

SASH3 sgRNA CRISPR Lentivector (Human) (Target 2)

K2090303 1.0 ug DNA
EUR 154

SASH3 sgRNA CRISPR Lentivector (Human) (Target 3)

K2090304 1.0 ug DNA
EUR 154

Sash3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3443602 1.0 ug DNA
EUR 154

Sash3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3443603 1.0 ug DNA
EUR 154

Sash3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3443604 1.0 ug DNA
EUR 154

Sash3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7446702 1.0 ug DNA
EUR 154

Sash3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7446703 1.0 ug DNA
EUR 154

Sash3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7446704 1.0 ug DNA
EUR 154

SASH3 Protein Vector (Human) (pPB-C-His)

PV036817 500 ng
EUR 329

SASH3 Protein Vector (Human) (pPB-N-His)

PV036818 500 ng
EUR 329

SASH3 Rabbit Polyclonal Antibody