SCNM1 Rabbit Polyclonal Antibody

SCNM1 Polyclonal Antibody

ABP60347-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human SCNM1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SCNM1 from Human. This SCNM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SCNM1 protein

SCNM1 Polyclonal Antibody

ABP60347-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SCNM1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SCNM1 from Human. This SCNM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SCNM1 protein

SCNM1 Polyclonal Antibody

ABP60347-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SCNM1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SCNM1 from Human. This SCNM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SCNM1 protein

SCNM1 Polyclonal Antibody

A60798 100 µg
EUR 570.55
Description: reagents widely cited

SCNM1 Antibody

ABD9928 100 ug
EUR 438

SCNM1 Antibody

46251-100ul 100ul
EUR 252

SCNM1 Antibody

46251-50ul 50ul
EUR 187

SCNM1 antibody

70R-20114 50 ul
EUR 435
Description: Rabbit polyclonal SCNM1 antibody

SCNM1 Antibody

DF9928 200ul
EUR 304
Description: SCNM1 Antibody detects endogenous levels of total SCNM1.

SCNM1 Antibody

1-CSB-PA020847GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SCNM1. Recognizes SCNM1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SCNM1 Antibody

1-CSB-PA020847LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCNM1. Recognizes SCNM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SCNM1 Polyclonal Antibody, Biotin Conjugated

A60799 100 µg
EUR 570.55
Description: Ask the seller for details

SCNM1 Polyclonal Antibody, FITC Conjugated

A60800 100 µg
EUR 570.55
Description: The best epigenetics products

SCNM1 Polyclonal Antibody, HRP Conjugated

A60801 100 µg
EUR 570.55
Description: kits suitable for this type of research

SCNM1 Conjugated Antibody

C46251 100ul
EUR 397

anti- SCNM1 antibody

FNab07647 100µg
EUR 548.75
  • Immunogen: sodium channel modifier 1
  • Uniprot ID: Q9BWG6
  • Gene ID: 79005
  • Research Area: Neuroscience
Description: Antibody raised against SCNM1

Anti-SCNM1 antibody

PAab07647 100 ug
EUR 386

Anti-SCNM1 antibody

STJ191433 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SCNM1

SCNM1 siRNA

20-abx932636
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SCNM1 siRNA

20-abx932637
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SCNM1 Antibody, HRP conjugated

1-CSB-PA020847LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCNM1. Recognizes SCNM1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SCNM1 Antibody, FITC conjugated

1-CSB-PA020847LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCNM1. Recognizes SCNM1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SCNM1 Antibody, Biotin conjugated

1-CSB-PA020847LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCNM1. Recognizes SCNM1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SCNM1 cloning plasmid

CSB-CL020847HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 693
  • Sequence: atgtctttcaagagggaaggagacgattggagtcaactcaatgtgctcaaaaaaagaagagtcggggacctcctagccagttacattccagaggatgaggcgctgatgcttcgggatggacgctttgcttgtgccatctgcccccatcgaccggtactggacaccctggccatgct
  • Show more
Description: A cloning plasmid for the SCNM1 gene.

SCNM1 Blocking Peptide

20-abx161219
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

SCNM1 Blocking Peptide

DF9928-BP 1mg
EUR 195

Anti-SCNM1 (1E10)

YF-MA19294 100 ug
EUR 363
Description: Mouse monoclonal to SCNM1

Mouse SCNM1 shRNA Plasmid

20-abx976902
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SCNM1 ELISA KIT|Human

EF002758 96 Tests
EUR 689

Human SCNM1 shRNA Plasmid

20-abx962248
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SCNM1 Recombinant Protein (Human)

RP027766 100 ug Ask for price

SCNM1 Recombinant Protein (Rat)

RP227705 100 ug Ask for price

SCNM1 Recombinant Protein (Mouse)

RP170318 100 ug Ask for price

SCNM1 Recombinant Protein (Mouse)

RP170321 100 ug Ask for price

Sodium Channel Modifier 1 (SCNM1) Antibody

20-abx121219
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Sodium Channel Modifier 1 (SCNM1) Antibody

20-abx218461
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Sodium Channel Modifier 1 (SCNM1) Antibody

abx237647-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Sodium Channel Modifier 1 (SCNM1) Antibody

20-abx301274
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Sodium Channel Modifier 1 (SCNM1) Antibody (HRP)

20-abx305246
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Sodium Channel Modifier 1 (SCNM1) Antibody (FITC)

20-abx305247
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Sodium Channel Modifier 1 (SCNM1) Antibody (Biotin)

20-abx305248
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

SCNM1 ORF Vector (Human) (pORF)

ORF009256 1.0 ug DNA
EUR 95

Scnm1 ORF Vector (Mouse) (pORF)

ORF056774 1.0 ug DNA
EUR 506

Scnm1 ORF Vector (Mouse) (pORF)

ORF056775 1.0 ug DNA
EUR 506

Scnm1 ORF Vector (Rat) (pORF)

ORF075903 1.0 ug DNA
EUR 506

SCNM1 sgRNA CRISPR Lentivector set (Human)

K2103401 3 x 1.0 ug
EUR 339

Scnm1 sgRNA CRISPR Lentivector set (Rat)

K6038401 3 x 1.0 ug
EUR 339

Scnm1 sgRNA CRISPR Lentivector set (Mouse)

K4922801 3 x 1.0 ug
EUR 339

SCNM1 Rabbit Polyclonal Antibody