SF3A1 Polyclonal Antibody |
ABP60372-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human SF3A1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SF3A1 from Human, Mouse. This SF3A1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SF3A1 protein |
SF3A1 Polyclonal Antibody |
ABP60372-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human SF3A1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SF3A1 from Human, Mouse. This SF3A1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SF3A1 protein |
SF3A1 Polyclonal Antibody |
ABP60372-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human SF3A1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SF3A1 from Human, Mouse. This SF3A1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SF3A1 protein |
SF3A1 Polyclonal Antibody |
30560-100ul |
SAB |
100ul |
EUR 252 |
SF3A1 Polyclonal Antibody |
30560-50ul |
SAB |
50ul |
EUR 187 |
SF3A1 Rabbit pAb |
A4399-100ul |
Abclonal |
100 ul |
EUR 308 |
SF3A1 Rabbit pAb |
A4399-200ul |
Abclonal |
200 ul |
EUR 459 |
SF3A1 Rabbit pAb |
A4399-20ul |
Abclonal |
20 ul |
EUR 183 |
SF3A1 Rabbit pAb |
A4399-50ul |
Abclonal |
50 ul |
EUR 223 |
SF3A1 Polyclonal Conjugated Antibody |
C30560 |
SAB |
100ul |
EUR 397 |
SF3A1 antibody |
70R-5001 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal SF3A1 antibody raised against the N terminal of SF3A1 |
SF3A1 antibody |
70R-4828 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal SF3A1 antibody raised against the N terminal of SF3A1 |
SF3A1 antibody |
70R-20192 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal SF3A1 antibody |
SF3A1 Antibody |
1-CSB-PA021121GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against SF3A1. Recognizes SF3A1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
anti- SF3A1 antibody |
FNab07774 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: splicing factor 3a, subunit 1, 120kDa
- Uniprot ID: Q15459
- Gene ID: 10291
- Research Area: Neuroscience, Metabolism, Epigenetics
|
Description: Antibody raised against SF3A1 |
Anti-SF3A1 antibody |
STJ11100905 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a subunit of the splicing factor 3a protein complex. The splicing factor 3a heterotrimer is a component of the mature U2 small nuclear ribonucleoprotein particle (snRNP). U2 small nuclear ribonucleoproteins play a critical role in spliceosome assembly and pre-mRNA splicing. |
Anti-SF3A1 antibody |
STJ191463 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to SF3A1 |
SF3A1 siRNA |
20-abx933083 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SF3A1 siRNA |
20-abx933084 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-SF3A1 |
YF-PA25535 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to SF3A1 |
SF3A1 cloning plasmid |
CSB-CL613594HU-10ug |
Cusabio |
10ug |
EUR 776 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2382
- Sequence: atgccggccggacccgtgcaggcggtgcccccgccgccgcccgtgcccacggagcccaaacagcccacagaagaagaagcatcttcaaaggaggattctgcaccttctaagccagttgtggggattatttaccctcctccagaggtcagaaatattgttgacaagactgccagct
- Show more
|
Description: A cloning plasmid for the SF3A1 gene. |
SF3A1 Blocking Peptide |
33R-7702 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SF3A1 antibody, catalog no. 70R-5001 |
SF3A1 Blocking Peptide |
33R-8124 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SF3A1 antibody, catalog no. 70R-4828 |
Mouse SF3A1 shRNA Plasmid |
20-abx976161 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human SF3A1 shRNA Plasmid |
20-abx956972 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SF3A1 Recombinant Protein (Human) |
RP028270 |
ABM |
100 ug |
Ask for price |
SF3A1 Recombinant Protein (Rat) |
RP228347 |
ABM |
100 ug |
Ask for price |
SF3A1 Recombinant Protein (Mouse) |
RP171314 |
ABM |
100 ug |
Ask for price |
Splicing Factor 3A Subunit 1 (SF3A1) Antibody |
abx237774-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
SF3A1 ORF Vector (Human) (pORF) |
ORF009424 |
ABM |
1.0 ug DNA |
EUR 95 |
Sf3a1 ORF Vector (Mouse) (pORF) |
ORF057106 |
ABM |
1.0 ug DNA |
EUR 506 |
Sf3a1 ORF Vector (Rat) (pORF) |
ORF076117 |
ABM |
1.0 ug DNA |
EUR 506 |
SF3A1 sgRNA CRISPR Lentivector set (Human) |
K2129901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Sf3a1 sgRNA CRISPR Lentivector set (Mouse) |
K3428301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Sf3a1 sgRNA CRISPR Lentivector set (Rat) |
K6401101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Splicing Factor 3A, Subunit 1, 120 kDa (SF3A1) Antibody |
20-abx115793 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SF3A1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2129902 |
ABM |
1.0 ug DNA |
EUR 154 |
SF3A1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2129903 |
ABM |
1.0 ug DNA |
EUR 154 |
SF3A1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2129904 |
ABM |
1.0 ug DNA |
EUR 154 |
Sf3a1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3428302 |
ABM |
1.0 ug DNA |
EUR 154 |
Sf3a1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3428303 |
ABM |
1.0 ug DNA |
EUR 154 |
Sf3a1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3428304 |
ABM |
1.0 ug DNA |
EUR 154 |
Sf3a1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6401102 |
ABM |
1.0 ug DNA |
EUR 154 |
Sf3a1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6401103 |
ABM |
1.0 ug DNA |
EUR 154 |
Sf3a1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6401104 |
ABM |
1.0 ug DNA |
EUR 154 |
SF3A1 Protein Vector (Human) (pPB-C-His) |
PV037693 |
ABM |
500 ng |
EUR 329 |
SF3A1 Protein Vector (Human) (pPB-N-His) |
PV037694 |
ABM |
500 ng |
EUR 329 |
SF3A1 Protein Vector (Human) (pPM-C-HA) |
PV037695 |
ABM |
500 ng |
EUR 329 |
SF3A1 Protein Vector (Human) (pPM-C-His) |
PV037696 |
ABM |
500 ng |
EUR 329 |
SF3A1 Protein Vector (Rat) (pPB-C-His) |
PV304466 |
ABM |
500 ng |
EUR 1191 |
SF3A1 Protein Vector (Rat) (pPB-N-His) |
PV304467 |
ABM |
500 ng |
EUR 1191 |
SF3A1 Protein Vector (Rat) (pPM-C-HA) |
PV304468 |
ABM |
500 ng |
EUR 1191 |
SF3A1 Protein Vector (Rat) (pPM-C-His) |
PV304469 |
ABM |
500 ng |
EUR 1191 |
SF3A1 Protein Vector (Mouse) (pPB-C-His) |
PV228422 |
ABM |
500 ng |
EUR 1065 |
SF3A1 Protein Vector (Mouse) (pPB-N-His) |
PV228423 |
ABM |
500 ng |
EUR 1065 |
SF3A1 Protein Vector (Mouse) (pPM-C-HA) |
PV228424 |
ABM |
500 ng |
EUR 1065 |
SF3A1 Protein Vector (Mouse) (pPM-C-His) |
PV228425 |
ABM |
500 ng |
EUR 1065 |
Sf3a1 3'UTR GFP Stable Cell Line |
TU168677 |
ABM |
1.0 ml |
Ask for price |
SF3A1 3'UTR Luciferase Stable Cell Line |
TU023012 |
ABM |
1.0 ml |
EUR 1521 |
Sf3a1 3'UTR Luciferase Stable Cell Line |
TU118677 |
ABM |
1.0 ml |
Ask for price |
SF3A1 3'UTR GFP Stable Cell Line |
TU073012 |
ABM |
1.0 ml |
EUR 1521 |
Sf3a1 3'UTR Luciferase Stable Cell Line |
TU220221 |
ABM |
1.0 ml |
Ask for price |
Sf3a1 3'UTR GFP Stable Cell Line |
TU270221 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
SF3A1 Rabbit Polyclonal Antibody