SF3A1 Rabbit Polyclonal Antibody

SF3A1 Polyclonal Antibody

ABP60372-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human SF3A1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SF3A1 from Human, Mouse. This SF3A1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SF3A1 protein

SF3A1 Polyclonal Antibody

ABP60372-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SF3A1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SF3A1 from Human, Mouse. This SF3A1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SF3A1 protein

SF3A1 Polyclonal Antibody

ABP60372-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SF3A1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SF3A1 from Human, Mouse. This SF3A1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SF3A1 protein

SF3A1 Polyclonal Antibody

30560-100ul 100ul
EUR 252

SF3A1 Polyclonal Antibody

30560-50ul 50ul
EUR 187

SF3A1 Rabbit pAb

A4399-100ul 100 ul
EUR 308

SF3A1 Rabbit pAb

A4399-200ul 200 ul
EUR 459

SF3A1 Rabbit pAb

A4399-20ul 20 ul
EUR 183

SF3A1 Rabbit pAb

A4399-50ul 50 ul
EUR 223

SF3A1 Polyclonal Conjugated Antibody

C30560 100ul
EUR 397

SF3A1 antibody

70R-5001 50 ug
EUR 467
Description: Rabbit polyclonal SF3A1 antibody raised against the N terminal of SF3A1

SF3A1 antibody

70R-4828 50 ug
EUR 467
Description: Rabbit polyclonal SF3A1 antibody raised against the N terminal of SF3A1

SF3A1 antibody

70R-20192 50 ul
EUR 435
Description: Rabbit polyclonal SF3A1 antibody

SF3A1 Antibody

1-CSB-PA021121GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SF3A1. Recognizes SF3A1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

anti- SF3A1 antibody

FNab07774 100µg
EUR 548.75
  • Immunogen: splicing factor 3a, subunit 1, 120kDa
  • Uniprot ID: Q15459
  • Gene ID: 10291
  • Research Area: Neuroscience, Metabolism, Epigenetics
Description: Antibody raised against SF3A1

Anti-SF3A1 antibody

PAab07774 100 ug
EUR 386

Anti-SF3A1 antibody

STJ11100905 100 µl
EUR 277
Description: This gene encodes a subunit of the splicing factor 3a protein complex. The splicing factor 3a heterotrimer is a component of the mature U2 small nuclear ribonucleoprotein particle (snRNP). U2 small nuclear ribonucleoproteins play a critical role in spliceosome assembly and pre-mRNA splicing.

Anti-SF3A1 antibody

STJ191463 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SF3A1

SF3A1 siRNA

20-abx933083
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SF3A1 siRNA

20-abx933084
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-SF3A1

YF-PA25535 50 ul
EUR 334
Description: Mouse polyclonal to SF3A1

SF3A1 cloning plasmid

CSB-CL613594HU-10ug 10ug
EUR 776
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2382
  • Sequence: atgccggccggacccgtgcaggcggtgcccccgccgccgcccgtgcccacggagcccaaacagcccacagaagaagaagcatcttcaaaggaggattctgcaccttctaagccagttgtggggattatttaccctcctccagaggtcagaaatattgttgacaagactgccagct
  • Show more
Description: A cloning plasmid for the SF3A1 gene.

SF3A1 Blocking Peptide

33R-7702 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SF3A1 antibody, catalog no. 70R-5001

SF3A1 Blocking Peptide

33R-8124 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SF3A1 antibody, catalog no. 70R-4828

Mouse SF3A1 shRNA Plasmid

20-abx976161
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SF3A1 ELISA KIT|Human

EF002850 96 Tests
EUR 689

Human SF3A1 shRNA Plasmid

20-abx956972
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SF3A1 Recombinant Protein (Human)

RP028270 100 ug Ask for price

SF3A1 Recombinant Protein (Rat)

RP228347 100 ug Ask for price

SF3A1 Recombinant Protein (Mouse)

RP171314 100 ug Ask for price

Splicing Factor 3A Subunit 1 (SF3A1) Antibody

abx237774-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

SF3A1 ORF Vector (Human) (pORF)

ORF009424 1.0 ug DNA
EUR 95

Sf3a1 ORF Vector (Mouse) (pORF)

ORF057106 1.0 ug DNA
EUR 506

Sf3a1 ORF Vector (Rat) (pORF)

ORF076117 1.0 ug DNA
EUR 506

SF3A1 sgRNA CRISPR Lentivector set (Human)

K2129901 3 x 1.0 ug
EUR 339

Sf3a1 sgRNA CRISPR Lentivector set (Mouse)

K3428301 3 x 1.0 ug
EUR 339

Sf3a1 sgRNA CRISPR Lentivector set (Rat)

K6401101 3 x 1.0 ug
EUR 339

Splicing Factor 3A, Subunit 1, 120 kDa (SF3A1) Antibody

20-abx115793
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

SF3A1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2129902 1.0 ug DNA
EUR 154

SF3A1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2129903 1.0 ug DNA
EUR 154

SF3A1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2129904 1.0 ug DNA
EUR 154

Sf3a1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3428302 1.0 ug DNA
EUR 154

Sf3a1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3428303 1.0 ug DNA
EUR 154

Sf3a1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3428304 1.0 ug DNA
EUR 154

Sf3a1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6401102 1.0 ug DNA
EUR 154

Sf3a1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6401103 1.0 ug DNA
EUR 154

Sf3a1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6401104 1.0 ug DNA
EUR 154

SF3A1 Protein Vector (Human) (pPB-C-His)

PV037693 500 ng
EUR 329

SF3A1 Protein Vector (Human) (pPB-N-His)

PV037694 500 ng
EUR 329

SF3A1 Protein Vector (Human) (pPM-C-HA)

PV037695 500 ng
EUR 329

SF3A1 Protein Vector (Human) (pPM-C-His)

PV037696 500 ng
EUR 329

SF3A1 Protein Vector (Rat) (pPB-C-His)

PV304466 500 ng
EUR 1191

SF3A1 Protein Vector (Rat) (pPB-N-His)

PV304467 500 ng
EUR 1191

SF3A1 Protein Vector (Rat) (pPM-C-HA)

PV304468 500 ng
EUR 1191

SF3A1 Protein Vector (Rat) (pPM-C-His)

PV304469 500 ng
EUR 1191

SF3A1 Protein Vector (Mouse) (pPB-C-His)

PV228422 500 ng
EUR 1065

SF3A1 Protein Vector (Mouse) (pPB-N-His)

PV228423 500 ng
EUR 1065

SF3A1 Protein Vector (Mouse) (pPM-C-HA)

PV228424 500 ng
EUR 1065

SF3A1 Protein Vector (Mouse) (pPM-C-His)

PV228425 500 ng
EUR 1065

Sf3a1 3'UTR GFP Stable Cell Line

TU168677 1.0 ml Ask for price

SF3A1 3'UTR Luciferase Stable Cell Line

TU023012 1.0 ml
EUR 1521

Sf3a1 3'UTR Luciferase Stable Cell Line

TU118677 1.0 ml Ask for price

SF3A1 3'UTR GFP Stable Cell Line

TU073012 1.0 ml
EUR 1521

Sf3a1 3'UTR Luciferase Stable Cell Line

TU220221 1.0 ml Ask for price

Sf3a1 3'UTR GFP Stable Cell Line

TU270221 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

SF3A1 Rabbit Polyclonal Antibody