Biocat Net

Amine biocat 3.0

SNPH Rabbit Polyclonal Antibody

SNPH Polyclonal Antibody

A61070 100 µg
EUR 570.55
Description: Ask the seller for details

SNPH Polyclonal Antibody

27674-100ul 100ul
EUR 252

SNPH Polyclonal Antibody

27674-50ul 50ul
EUR 187

SNPH Rabbit pAb

A12300-100ul 100 ul
EUR 308

SNPH Rabbit pAb

A12300-200ul 200 ul
EUR 459

SNPH Rabbit pAb

A12300-20ul 20 ul
EUR 183

SNPH Rabbit pAb

A12300-50ul 50 ul
EUR 223

SNPH Polyclonal Conjugated Antibody

C27674 100ul
EUR 397

SNPH antibody

70R-20426 50 ul
EUR 435
Description: Rabbit polyclonal SNPH antibody

SNPH Antibody

1-CSB-PA022317GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SNPH. Recognizes SNPH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SNPH Antibody

1-CSB-PA022317LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SNPH. Recognizes SNPH from Human. This antibody is Unconjugated. Tested in the following application: ELISA

Polyclonal SNPH Antibody (N-Terminus)

APR13440G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SNPH (N-Terminus). This antibody is tested and proven to work in the following applications:

SNPH Polyclonal Antibody, Biotin Conjugated

A61071 100 µg
EUR 570.55
Description: The best epigenetics products

SNPH Polyclonal Antibody, FITC Conjugated

A61072 100 µg
EUR 570.55
Description: kits suitable for this type of research

SNPH Polyclonal Antibody, HRP Conjugated

A61073 100 µg
EUR 570.55
Description: fast delivery possible

Snph/ Rat Snph ELISA Kit

ELI-29796r 96 Tests
EUR 886

Syntaphilin (SNPH) Antibody

20-abx126613
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Syntaphilin (SNPH) Antibody

20-abx115966
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Syntaphilin (SNPH) Antibody

abx238443-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Syntaphilin (SNPH) Antibody

20-abx305377
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-SNPH antibody

STJ114188 100 µl
EUR 277
Description: Syntaxin-1, synaptobrevin/VAMP, and SNAP25 interact to form the SNARE complex, which is required for synaptic vesicle docking and fusion. The protein encoded by this gene is membrane-associated and inhibits SNARE complex formation by binding free syntaxin-1. Expression of this gene appears to be brain-specific. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-SNPH antibody

STJ191498 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SNPH

SNPH siRNA

20-abx905183
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SNPH siRNA

20-abx934527
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SNPH siRNA

20-abx934528
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-SNPH

YF-PA16505 50 ug
EUR 363
Description: Mouse polyclonal to SNPH

Syntaphilin (SNPH) Antibody (HRP)

20-abx305378
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Syntaphilin (SNPH) Antibody (FITC)

20-abx305379
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Syntaphilin (SNPH) Antibody (Biotin)

20-abx305380
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

SNPH Antibody, HRP conjugated

1-CSB-PA022317LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SNPH. Recognizes SNPH from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SNPH Antibody, FITC conjugated

1-CSB-PA022317LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SNPH. Recognizes SNPH from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SNPH Antibody, Biotin conjugated

1-CSB-PA022317LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SNPH. Recognizes SNPH from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SNPH cloning plasmid

CSB-CL022317HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1485
  • Sequence: atggccatgtccctgccaggaagtagacggacctctgctggatcacgcaggcgcacctctccacctgtgagcgtgcgggatgcctacggcacctcttcgctcagcagcagcagcaattctggctcctacaagggcagtgacagcagtcccacgccaaggcgctccatgaaataca
  • Show more
Description: A cloning plasmid for the SNPH gene.

Syntaphilin (SNPH) Protein

20-abx260446
  • EUR 230.00
  • EUR 2332.00
  • EUR 328.00
  • 10 ug
  • 1 mg
  • 50 ug
  • Shipped within 5-10 working days.

Human Syntaphilin (SNPH)

1-CSB-EP022317HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 62 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Syntaphilin(SNPH),partial expressed in E.coli

Anti-SNPH (3B6)

YF-MA16997 100 ug
EUR 363
Description: Mouse monoclonal to SNPH

Rat SNPH shRNA Plasmid

20-abx988795
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SNPH shRNA Plasmid

20-abx956518
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse SNPH shRNA Plasmid

20-abx982537
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SNPH Recombinant Protein (Human)

RP029527 100 ug Ask for price

SNPH Recombinant Protein (Rat)

RP230270 100 ug Ask for price

SNPH Recombinant Protein (Mouse)

RP174206 100 ug Ask for price

Mouse Syntaphilin, Snph ELISA KIT

ELI-13921m 96 Tests
EUR 865

Human Syntaphilin, SNPH ELISA KIT

ELI-39444h 96 Tests
EUR 824

Human Syntaphilin (SNPH) ELISA Kit

20-abx383603
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Syntaphilin (SNPH) ELISA Kit

abx383604-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

SNPH Syntaphilin Human Recombinant Protein

PROTO15079 Regular: 50ug
EUR 317
Description: SNPH Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 444 amino acids (1-424) and having a molecular mass of 48.2 kDa.;The SNPH is fused to 20 amino acid His-Tag at N-terminus and purified by standard chromatography techniques.

Snph ORF Vector (Mouse) (pORF)

ORF058070 1.0 ug DNA
EUR 506

SNPH ORF Vector (Human) (pORF)

ORF009843 1.0 ug DNA
EUR 95

Snph ORF Vector (Rat) (pORF)

ORF076758 1.0 ug DNA
EUR 506

Human Syntaphilin(SNPH)ELISA Kit

QY-E01676 96T
EUR 361

SNPH sgRNA CRISPR Lentivector set (Human)

K2249801 3 x 1.0 ug
EUR 339

Snph sgRNA CRISPR Lentivector set (Mouse)

K4402701 3 x 1.0 ug
EUR 339

Snph sgRNA CRISPR Lentivector set (Rat)

K6265401 3 x 1.0 ug
EUR 339

SNPH sgRNA CRISPR Lentivector (Human) (Target 1)

K2249802 1.0 ug DNA
EUR 154

SNPH sgRNA CRISPR Lentivector (Human) (Target 2)

K2249803 1.0 ug DNA
EUR 154

SNPH sgRNA CRISPR Lentivector (Human) (Target 3)

K2249804 1.0 ug DNA
EUR 154

Snph sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4402702 1.0 ug DNA
EUR 154

Snph sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4402703 1.0 ug DNA
EUR 154

Snph sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4402704 1.0 ug DNA
EUR 154

Snph sgRNA CRISPR Lentivector (Rat) (Target 1)

K6265402 1.0 ug DNA
EUR 154

Snph sgRNA CRISPR Lentivector (Rat) (Target 2)

K6265403 1.0 ug DNA
EUR 154

Snph sgRNA CRISPR Lentivector (Rat) (Target 3)

K6265404 1.0 ug DNA
EUR 154

SNPH Protein Vector (Human) (pPB-C-His)

PV039369 500 ng
EUR 329

SNPH Protein Vector (Human) (pPB-N-His)

PV039370 500 ng
EUR 329

SNPH Protein Vector (Human) (pPM-C-HA)

PV039371 500 ng
EUR 329

SNPH Protein Vector (Human) (pPM-C-His)

PV039372 500 ng
EUR 329

SNPH Protein Vector (Rat) (pPB-C-His)

PV307030 500 ng
EUR 603

SNPH Protein Vector (Rat) (pPB-N-His)

PV307031 500 ng
EUR 603

SNPH Protein Vector (Rat) (pPM-C-HA)

PV307032 500 ng
EUR 603

SNPH Protein Vector (Rat) (pPM-C-His)

PV307033 500 ng
EUR 603

SNPH Protein Vector (Mouse) (pPB-C-His)

PV232278 500 ng
EUR 603

SNPH Protein Vector (Mouse) (pPB-N-His)

PV232279 500 ng
EUR 603

SNPH Protein Vector (Mouse) (pPM-C-HA)

PV232280 500 ng
EUR 603

SNPH Protein Vector (Mouse) (pPM-C-His)

PV232281 500 ng
EUR 603

Snph 3'UTR GFP Stable Cell Line

TU169388 1.0 ml Ask for price

SNPH 3'UTR Luciferase Stable Cell Line

TU024226 1.0 ml
EUR 2333

Snph 3'UTR Luciferase Stable Cell Line

TU119388 1.0 ml Ask for price

SNPH 3'UTR GFP Stable Cell Line

TU074226 1.0 ml
EUR 2333

Snph 3'UTR Luciferase Stable Cell Line

TU220895 1.0 ml Ask for price

Snph 3'UTR GFP Stable Cell Line

TU270895 1.0 ml Ask for price

SNPH Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV697849 1.0 ug DNA
EUR 682

SNPH Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV697853 1.0 ug DNA
EUR 682

SNPH Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV697854 1.0 ug DNA
EUR 682

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

SNPH Rabbit Polyclonal Antibody