SNPH Polyclonal Antibody |
ABP60452-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human SNPH protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SNPH from Human, Mouse, Rat. This SNPH antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SNPH protein |
SNPH Polyclonal Antibody |
ES10340-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against SNPH from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
SNPH Polyclonal Antibody |
ES10340-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against SNPH from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
SNPH Rabbit pAb |
A12300-100ul |
Abclonal |
100 ul |
EUR 308 |
SNPH Rabbit pAb |
A12300-200ul |
Abclonal |
200 ul |
EUR 459 |
SNPH Rabbit pAb |
A12300-20ul |
Abclonal |
20 ul |
EUR 183 |
SNPH Rabbit pAb |
A12300-50ul |
Abclonal |
50 ul |
EUR 223 |
SNPH Polyclonal Conjugated Antibody |
C27674 |
SAB |
100ul |
EUR 397 |
SNPH antibody |
70R-20426 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal SNPH antibody |
SNPH Antibody |
1-CSB-PA022317GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against SNPH. Recognizes SNPH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
SNPH Antibody |
1-CSB-PA022317LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SNPH. Recognizes SNPH from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
Polyclonal SNPH Antibody (N-Terminus) |
APR13440G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SNPH (N-Terminus). This antibody is tested and proven to work in the following applications: |
SNPH Polyclonal Antibody, Biotin Conjugated |
A61071 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
SNPH Polyclonal Antibody, FITC Conjugated |
A61072 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
SNPH Polyclonal Antibody, HRP Conjugated |
A61073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
Syntaphilin (SNPH) Antibody |
20-abx115966 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Syntaphilin (SNPH) Antibody |
20-abx126613 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Syntaphilin (SNPH) Antibody |
abx238443-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Syntaphilin (SNPH) Antibody |
20-abx305377 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-SNPH antibody |
STJ114188 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Syntaxin-1, synaptobrevin/VAMP, and SNAP25 interact to form the SNARE complex, which is required for synaptic vesicle docking and fusion. The protein encoded by this gene is membrane-associated and inhibits SNARE complex formation by binding free syntaxin-1. Expression of this gene appears to be brain-specific. Alternative splicing results in multiple transcript variants encoding different isoforms. |
Anti-SNPH antibody |
STJ191498 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to SNPH |
SNPH siRNA |
20-abx905183 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SNPH siRNA |
20-abx934527 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SNPH siRNA |
20-abx934528 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-SNPH |
YF-PA16505 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to SNPH |
SNPH Antibody, HRP conjugated |
1-CSB-PA022317LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SNPH. Recognizes SNPH from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
SNPH Antibody, FITC conjugated |
1-CSB-PA022317LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SNPH. Recognizes SNPH from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
SNPH Antibody, Biotin conjugated |
1-CSB-PA022317LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SNPH. Recognizes SNPH from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Syntaphilin (SNPH) Antibody (HRP) |
20-abx305378 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Syntaphilin (SNPH) Antibody (FITC) |
20-abx305379 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Syntaphilin (SNPH) Antibody (Biotin) |
20-abx305380 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human Syntaphilin (SNPH) |
1-CSB-EP022317HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 62 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Syntaphilin(SNPH),partial expressed in E.coli |
Syntaphilin (SNPH) Protein |
20-abx260446 |
Abbexa |
-
EUR 230.00
-
EUR 2332.00
-
EUR 328.00
|
|
- Shipped within 5-10 working days.
|
SNPH cloning plasmid |
CSB-CL022317HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1485
- Sequence: atggccatgtccctgccaggaagtagacggacctctgctggatcacgcaggcgcacctctccacctgtgagcgtgcgggatgcctacggcacctcttcgctcagcagcagcagcaattctggctcctacaagggcagtgacagcagtcccacgccaaggcgctccatgaaataca
- Show more
|
Description: A cloning plasmid for the SNPH gene. |
Anti-SNPH (3B6) |
YF-MA16997 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to SNPH |
Rat SNPH shRNA Plasmid |
20-abx988795 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human SNPH shRNA Plasmid |
20-abx956518 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse SNPH shRNA Plasmid |
20-abx982537 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SNPH Recombinant Protein (Rat) |
RP230270 |
ABM |
100 ug |
Ask for price |
SNPH Recombinant Protein (Human) |
RP029527 |
ABM |
100 ug |
Ask for price |
SNPH Recombinant Protein (Mouse) |
RP174206 |
ABM |
100 ug |
Ask for price |
Human Syntaphilin (SNPH) ELISA Kit |
20-abx383603 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
Human Syntaphilin (SNPH) ELISA Kit |
abx383604-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Snph ORF Vector (Rat) (pORF) |
ORF076758 |
ABM |
1.0 ug DNA |
EUR 506 |
SNPH ORF Vector (Human) (pORF) |
ORF009843 |
ABM |
1.0 ug DNA |
EUR 95 |
Snph ORF Vector (Mouse) (pORF) |
ORF058070 |
ABM |
1.0 ug DNA |
EUR 506 |
SNPH Syntaphilin Human Recombinant Protein |
PROTO15079 |
BosterBio |
Regular: 50ug |
EUR 317 |
Description: SNPH Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 444 amino acids (1-424) and having a molecular mass of 48.2 kDa.;The SNPH is fused to 20 amino acid His-Tag at N-terminus and purified by standard chromatography techniques. |
Snph sgRNA CRISPR Lentivector set (Rat) |
K6265401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Snph sgRNA CRISPR Lentivector set (Mouse) |
K4402701 |
ABM |
3 x 1.0 ug |
EUR 339 |
SNPH sgRNA CRISPR Lentivector set (Human) |
K2249801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Snph sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6265402 |
ABM |
1.0 ug DNA |
EUR 154 |
Snph sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6265403 |
ABM |
1.0 ug DNA |
EUR 154 |
Snph sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6265404 |
ABM |
1.0 ug DNA |
EUR 154 |
Snph sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4402702 |
ABM |
1.0 ug DNA |
EUR 154 |
Snph sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4402703 |
ABM |
1.0 ug DNA |
EUR 154 |
Snph sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4402704 |
ABM |
1.0 ug DNA |
EUR 154 |
SNPH sgRNA CRISPR Lentivector (Human) (Target 1) |
K2249802 |
ABM |
1.0 ug DNA |
EUR 154 |
SNPH sgRNA CRISPR Lentivector (Human) (Target 2) |
K2249803 |
ABM |
1.0 ug DNA |
EUR 154 |
SNPH sgRNA CRISPR Lentivector (Human) (Target 3) |
K2249804 |
ABM |
1.0 ug DNA |
EUR 154 |
SNPH Protein Vector (Rat) (pPB-C-His) |
PV307030 |
ABM |
500 ng |
EUR 603 |
SNPH Protein Vector (Rat) (pPB-N-His) |
PV307031 |
ABM |
500 ng |
EUR 603 |
SNPH Protein Vector (Rat) (pPM-C-HA) |
PV307032 |
ABM |
500 ng |
EUR 603 |
SNPH Protein Vector (Rat) (pPM-C-His) |
PV307033 |
ABM |
500 ng |
EUR 603 |
SNPH Protein Vector (Human) (pPB-C-His) |
PV039369 |
ABM |
500 ng |
EUR 329 |
SNPH Protein Vector (Human) (pPB-N-His) |
PV039370 |
ABM |
500 ng |
EUR 329 |
SNPH Protein Vector (Human) (pPM-C-HA) |
PV039371 |
ABM |
500 ng |
EUR 329 |
SNPH Protein Vector (Human) (pPM-C-His) |
PV039372 |
ABM |
500 ng |
EUR 329 |
SNPH Protein Vector (Mouse) (pPB-C-His) |
PV232278 |
ABM |
500 ng |
EUR 603 |
SNPH Protein Vector (Mouse) (pPB-N-His) |
PV232279 |
ABM |
500 ng |
EUR 603 |
SNPH Protein Vector (Mouse) (pPM-C-HA) |
PV232280 |
ABM |
500 ng |
EUR 603 |
SNPH Protein Vector (Mouse) (pPM-C-His) |
PV232281 |
ABM |
500 ng |
EUR 603 |
Snph 3'UTR Luciferase Stable Cell Line |
TU119388 |
ABM |
1.0 ml |
Ask for price |
Snph 3'UTR GFP Stable Cell Line |
TU169388 |
ABM |
1.0 ml |
Ask for price |
Snph 3'UTR Luciferase Stable Cell Line |
TU220895 |
ABM |
1.0 ml |
Ask for price |
Snph 3'UTR GFP Stable Cell Line |
TU270895 |
ABM |
1.0 ml |
Ask for price |
SNPH 3'UTR GFP Stable Cell Line |
TU074226 |
ABM |
1.0 ml |
EUR 2333 |
SNPH 3'UTR Luciferase Stable Cell Line |
TU024226 |
ABM |
1.0 ml |
EUR 2333 |
SNPH Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV697849 |
ABM |
1.0 ug DNA |
EUR 682 |
SNPH Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV697853 |
ABM |
1.0 ug DNA |
EUR 682 |
SNPH Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV697854 |
ABM |
1.0 ug DNA |
EUR 682 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
SNPH Rabbit Polyclonal Antibody