SOAT1 Rabbit Polyclonal Antibody

SOAT1 Rabbit pAb
A6311-100ul 100 ul
EUR 308

SOAT1 Rabbit pAb
A6311-200ul 200 ul
EUR 459

SOAT1 Rabbit pAb
A6311-20ul 20 ul
EUR 183

SOAT1 Rabbit pAb
A6311-50ul 50 ul
EUR 223

SOAT1 antibody
70R-8626 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SOAT1 antibody

SOAT1 Antibody
ABD7778 100 ug
EUR 438

SOAT1 Antibody
ABD7779 100 ug
EUR 438

SOAT1 antibody
38815-100ul 100ul
EUR 252

SOAT1 Antibody
DF7778 200ul
EUR 304
Description: SOAT1 Antibody detects endogenous levels of total SOAT1.

SOAT1 Antibody
1-CSB-PA022385DSR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SOAT1. Recognizes SOAT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

SOAT1 Antibody
1-CSB-PA022385DSR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SOAT1. Recognizes SOAT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Polyclonal SOAT1 antibody - middle region
APR10169G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SOAT1 - middle region. This antibody is tested and proven to work in the following applications:

Soat1/ Rat Soat1 ELISA Kit
ELI-29587r 96 Tests
EUR 886

SOAT1 Conjugated Antibody
C38815 100ul
EUR 397

Anti-SOAT1 antibody
STJ28233 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the acyltransferase family. It is located in the endoplasmic reticulum, and catalyzes the formation of fatty acid-cholesterol esters. This gene has been implicated in the formation of beta-amyloid and atherosclerotic plaques by controlling the equilibrium between free cholesterol and cytoplasmic cholesteryl esters. Alternatively spliced transcript variants have been found for this gene.

Anti-SOAT1 antibody
STJ191474 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SOAT1

SOAT1 siRNA
20-abx905198
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SOAT1 siRNA
20-abx934640
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SOAT1 siRNA
20-abx934641
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-SOAT1
YF-PA14731 100 ul
EUR 403
Description: Rabbit polyclonal to SOAT1

SOAT1 cloning plasmid
CSB-CL022385HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1653
  • Sequence: atggtgggtgaagagaagatgtctctaagaaaccggctgtcaaagtccagggaaaatcctgaggaagatgaagaccagagaaaccctgcaaaggagtccctagagacacctagtaatggtcgaattgacataaaacagttgatagcaaagaagataaagttgacagcagaggcag
  • Show more
Description: A cloning plasmid for the SOAT1 gene.

SOAT1 Blocking Peptide
33R-1527 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SOAT1 antibody, catalog no. 70R-8626

SOAT1 Blocking Peptide
DF7778-BP 1mg
EUR 195

Rat SOAT1 shRNA Plasmid
20-abx986714
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SOAT1 shRNA Plasmid
20-abx954526
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse SOAT1 shRNA Plasmid
20-abx972814
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SOAT1 Recombinant Protein (Human)
RP029665 100 ug Ask for price

SOAT1 Recombinant Protein (Rat)
RP230426 100 ug Ask for price

SOAT1 Recombinant Protein (Mouse)
RP174425 100 ug Ask for price

Sterol O-Acyltransferase 1 (SOAT1) Antibody
20-abx142236
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol O-Acyltransferase 1 (SOAT1) Antibody
20-abx004824
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol O-Acyltransferase 1 (SOAT1) Antibody
20-abx320400
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol O-Acyltransferase 1 (SOAT1) Antibody
20-abx321595
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Soat1 ORF Vector (Mouse) (pORF)
ORF058143 1.0 ug DNA
EUR 506

SOAT1 ORF Vector (Human) (pORF)
ORF009889 1.0 ug DNA
EUR 95

Soat1 ORF Vector (Rat) (pORF)
ORF076810 1.0 ug DNA
EUR 506

SOAT1 sgRNA CRISPR Lentivector set (Human)
K2256701 3 x 1.0 ug
EUR 339

Soat1 sgRNA CRISPR Lentivector set (Mouse)
K4820501 3 x 1.0 ug
EUR 339

Soat1 sgRNA CRISPR Lentivector set (Rat)
K7034301 3 x 1.0 ug
EUR 339

SOAT1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2256702 1.0 ug DNA
EUR 154

SOAT1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2256703 1.0 ug DNA
EUR 154

SOAT1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2256704 1.0 ug DNA
EUR 154

Soat1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4820502 1.0 ug DNA
EUR 154

Soat1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4820503 1.0 ug DNA
EUR 154

Soat1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4820504 1.0 ug DNA
EUR 154

Soat1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7034302 1.0 ug DNA
EUR 154

Soat1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7034303 1.0 ug DNA
EUR 154

Soat1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7034304 1.0 ug DNA
EUR 154

SOAT1 Protein Vector (Human) (pPB-C-His)
PV039553 500 ng
EUR 329

SOAT1 Protein Vector (Human) (pPB-N-His)
PV039554 500 ng
EUR 329

SOAT1 Protein Vector (Human) (pPM-C-HA)
PV039555 500 ng
EUR 329

SOAT1 Protein Vector (Human) (pPM-C-His)
PV039556 500 ng
EUR 329

SOAT1 Protein Vector (Rat) (pPB-C-His)
PV307238 500 ng
EUR 603

SOAT1 Protein Vector (Rat) (pPB-N-His)
PV307239 500 ng
EUR 603

SOAT1 Protein Vector (Rat) (pPM-C-HA)
PV307240 500 ng
EUR 603

SOAT1 Protein Vector (Rat) (pPM-C-His)
PV307241 500 ng
EUR 603

SOAT1 Protein Vector (Mouse) (pPB-C-His)
PV232570 500 ng
EUR 603

SOAT1 Protein Vector (Mouse) (pPB-N-His)
PV232571 500 ng
EUR 603

SOAT1 Protein Vector (Mouse) (pPM-C-HA)
PV232572 500 ng
EUR 603

SOAT1 Protein Vector (Mouse) (pPM-C-His)
PV232573 500 ng
EUR 603

Soat1 3'UTR GFP Stable Cell Line
TU169448 1.0 ml Ask for price

SOAT1 3'UTR Luciferase Stable Cell Line
TU024298 1.0 ml
EUR 4617

Soat1 3'UTR Luciferase Stable Cell Line
TU119448 1.0 ml Ask for price

SOAT1 3'UTR GFP Stable Cell Line
TU074298 1.0 ml
EUR 4617

Soat1 3'UTR Luciferase Stable Cell Line
TU220953 1.0 ml Ask for price

Soat1 3'UTR GFP Stable Cell Line
TU270953 1.0 ml Ask for price

Human Sterol O- acyltransferase 1, SOAT1 ELISA KIT
ELI-19087h 96 Tests
EUR 824

Mouse Sterol O- acyltransferase 1, Soat1 ELISA KIT
ELI-30139m 96 Tests
EUR 865

Human Sterol-O-Acyltransferase 1 (SOAT1)ELISA Kit
201-12-2394 96 tests
EUR 440
  • This Sterol-O-Acyltransferase 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

SOAT1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV655765 1.0 ug DNA
EUR 682

SOAT1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV655769 1.0 ug DNA
EUR 682

SOAT1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV655770 1.0 ug DNA
EUR 682

SOAT1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV792907 1.0 ug DNA
EUR 316

SOAT1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV792908 1.0 ug DNA
EUR 316

Human Sterol-O-Acyltransferase 1(SOAT1)ELISA Kit
QY-E00341 96T
EUR 394

Rat Sterol-O-Acyltransferase 1(SOAT1)ELISA Kit
QY-E10475 96T
EUR 361

Mouse Sterol-O-Acyltransferase 1(SOAT1)ELISA Kit
QY-E21400 96T
EUR 361

VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

SOAT1 Rabbit Polyclonal Antibody