SOAT1 Rabbit pAb |
A6311-100ul |
Abclonal |
100 ul |
EUR 308 |
SOAT1 Rabbit pAb |
A6311-200ul |
Abclonal |
200 ul |
EUR 459 |
SOAT1 Rabbit pAb |
A6311-20ul |
Abclonal |
20 ul |
EUR 183 |
SOAT1 Rabbit pAb |
A6311-50ul |
Abclonal |
50 ul |
EUR 223 |
SOAT1 antibody |
70R-8626 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal SOAT1 antibody |
SOAT1 antibody |
38815-100ul |
SAB |
100ul |
EUR 252 |
SOAT1 Antibody |
DF7778 |
Affbiotech |
200ul |
EUR 304 |
Description: SOAT1 Antibody detects endogenous levels of total SOAT1. |
SOAT1 Antibody |
1-CSB-PA022385DSR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against SOAT1. Recognizes SOAT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
SOAT1 Antibody |
1-CSB-PA022385DSR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against SOAT1. Recognizes SOAT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Polyclonal SOAT1 antibody - middle region |
APR10169G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SOAT1 - middle region. This antibody is tested and proven to work in the following applications: |
SOAT1 Conjugated Antibody |
C38815 |
SAB |
100ul |
EUR 397 |
Anti-SOAT1 antibody |
STJ28233 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene belongs to the acyltransferase family. It is located in the endoplasmic reticulum, and catalyzes the formation of fatty acid-cholesterol esters. This gene has been implicated in the formation of beta-amyloid and atherosclerotic plaques by controlling the equilibrium between free cholesterol and cytoplasmic cholesteryl esters. Alternatively spliced transcript variants have been found for this gene. |
Anti-SOAT1 antibody |
STJ191474 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to SOAT1 |
SOAT1 siRNA |
20-abx905198 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SOAT1 siRNA |
20-abx934640 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SOAT1 siRNA |
20-abx934641 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-SOAT1 |
YF-PA14731 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to SOAT1 |
SOAT1 cloning plasmid |
CSB-CL022385HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1653
- Sequence: atggtgggtgaagagaagatgtctctaagaaaccggctgtcaaagtccagggaaaatcctgaggaagatgaagaccagagaaaccctgcaaaggagtccctagagacacctagtaatggtcgaattgacataaaacagttgatagcaaagaagataaagttgacagcagaggcag
- Show more
|
Description: A cloning plasmid for the SOAT1 gene. |
SOAT1 Blocking Peptide |
33R-1527 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SOAT1 antibody, catalog no. 70R-8626 |
SOAT1 Blocking Peptide |
DF7778-BP |
Affbiotech |
1mg |
EUR 195 |
Rat SOAT1 shRNA Plasmid |
20-abx986714 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human SOAT1 shRNA Plasmid |
20-abx954526 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse SOAT1 shRNA Plasmid |
20-abx972814 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SOAT1 Recombinant Protein (Human) |
RP029665 |
ABM |
100 ug |
Ask for price |
SOAT1 Recombinant Protein (Rat) |
RP230426 |
ABM |
100 ug |
Ask for price |
SOAT1 Recombinant Protein (Mouse) |
RP174425 |
ABM |
100 ug |
Ask for price |
Sterol O-Acyltransferase 1 (SOAT1) Antibody |
20-abx142236 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Sterol O-Acyltransferase 1 (SOAT1) Antibody |
20-abx004824 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Sterol O-Acyltransferase 1 (SOAT1) Antibody |
20-abx320400 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Sterol O-Acyltransferase 1 (SOAT1) Antibody |
20-abx321595 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Soat1 ORF Vector (Mouse) (pORF) |
ORF058143 |
ABM |
1.0 ug DNA |
EUR 506 |
SOAT1 ORF Vector (Human) (pORF) |
ORF009889 |
ABM |
1.0 ug DNA |
EUR 95 |
Soat1 ORF Vector (Rat) (pORF) |
ORF076810 |
ABM |
1.0 ug DNA |
EUR 506 |
SOAT1 sgRNA CRISPR Lentivector set (Human) |
K2256701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Soat1 sgRNA CRISPR Lentivector set (Mouse) |
K4820501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Soat1 sgRNA CRISPR Lentivector set (Rat) |
K7034301 |
ABM |
3 x 1.0 ug |
EUR 339 |
SOAT1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2256702 |
ABM |
1.0 ug DNA |
EUR 154 |
SOAT1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2256703 |
ABM |
1.0 ug DNA |
EUR 154 |
SOAT1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2256704 |
ABM |
1.0 ug DNA |
EUR 154 |
Soat1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4820502 |
ABM |
1.0 ug DNA |
EUR 154 |
Soat1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4820503 |
ABM |
1.0 ug DNA |
EUR 154 |
Soat1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4820504 |
ABM |
1.0 ug DNA |
EUR 154 |
Soat1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7034302 |
ABM |
1.0 ug DNA |
EUR 154 |
Soat1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7034303 |
ABM |
1.0 ug DNA |
EUR 154 |
Soat1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7034304 |
ABM |
1.0 ug DNA |
EUR 154 |
SOAT1 Protein Vector (Human) (pPB-C-His) |
PV039553 |
ABM |
500 ng |
EUR 329 |
SOAT1 Protein Vector (Human) (pPB-N-His) |
PV039554 |
ABM |
500 ng |
EUR 329 |
SOAT1 Protein Vector (Human) (pPM-C-HA) |
PV039555 |
ABM |
500 ng |
EUR 329 |
SOAT1 Protein Vector (Human) (pPM-C-His) |
PV039556 |
ABM |
500 ng |
EUR 329 |
SOAT1 Protein Vector (Rat) (pPB-C-His) |
PV307238 |
ABM |
500 ng |
EUR 603 |
SOAT1 Protein Vector (Rat) (pPB-N-His) |
PV307239 |
ABM |
500 ng |
EUR 603 |
SOAT1 Protein Vector (Rat) (pPM-C-HA) |
PV307240 |
ABM |
500 ng |
EUR 603 |
SOAT1 Protein Vector (Rat) (pPM-C-His) |
PV307241 |
ABM |
500 ng |
EUR 603 |
SOAT1 Protein Vector (Mouse) (pPB-C-His) |
PV232570 |
ABM |
500 ng |
EUR 603 |
SOAT1 Protein Vector (Mouse) (pPB-N-His) |
PV232571 |
ABM |
500 ng |
EUR 603 |
SOAT1 Protein Vector (Mouse) (pPM-C-HA) |
PV232572 |
ABM |
500 ng |
EUR 603 |
SOAT1 Protein Vector (Mouse) (pPM-C-His) |
PV232573 |
ABM |
500 ng |
EUR 603 |
Soat1 3'UTR GFP Stable Cell Line |
TU169448 |
ABM |
1.0 ml |
Ask for price |
SOAT1 3'UTR Luciferase Stable Cell Line |
TU024298 |
ABM |
1.0 ml |
EUR 4617 |
Soat1 3'UTR Luciferase Stable Cell Line |
TU119448 |
ABM |
1.0 ml |
Ask for price |
SOAT1 3'UTR GFP Stable Cell Line |
TU074298 |
ABM |
1.0 ml |
EUR 4617 |
Soat1 3'UTR Luciferase Stable Cell Line |
TU220953 |
ABM |
1.0 ml |
Ask for price |
Soat1 3'UTR GFP Stable Cell Line |
TU270953 |
ABM |
1.0 ml |
Ask for price |
Human Sterol O- acyltransferase 1, SOAT1 ELISA KIT |
ELI-19087h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse Sterol O- acyltransferase 1, Soat1 ELISA KIT |
ELI-30139m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Sterol-O-Acyltransferase 1 (SOAT1)ELISA Kit |
201-12-2394 |
SunredBio |
96 tests |
EUR 440 |
- This Sterol-O-Acyltransferase 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
SOAT1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV655765 |
ABM |
1.0 ug DNA |
EUR 682 |
SOAT1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV655769 |
ABM |
1.0 ug DNA |
EUR 682 |
SOAT1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV655770 |
ABM |
1.0 ug DNA |
EUR 682 |
SOAT1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV792907 |
ABM |
1.0 ug DNA |
EUR 316 |
SOAT1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV792908 |
ABM |
1.0 ug DNA |
EUR 316 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
SOAT1 Rabbit Polyclonal Antibody