Biocat Net

Amine biocat 3.0

SOAT1 Rabbit Polyclonal Antibody

SOAT1 Rabbit pAb

A6311-100ul 100 ul
EUR 308

SOAT1 Rabbit pAb

A6311-200ul 200 ul
EUR 459

SOAT1 Rabbit pAb

A6311-20ul 20 ul
EUR 183

SOAT1 Rabbit pAb

A6311-50ul 50 ul
EUR 223

SOAT1 antibody

38815-100ul 100ul
EUR 252

SOAT1 Antibody

DF7778 200ul
EUR 304
Description: SOAT1 Antibody detects endogenous levels of total SOAT1.

SOAT1 antibody

70R-8626 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SOAT1 antibody

SOAT1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SOAT1. Recognizes SOAT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

SOAT1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SOAT1. Recognizes SOAT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SOAT1 Antibody

ABD7778 100 ug
EUR 438

SOAT1 Antibody

ABD7779 100 ug
EUR 438

Polyclonal SOAT1 antibody - middle region

APR10169G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SOAT1 - middle region. This antibody is tested and proven to work in the following applications:

Soat1/ Rat Soat1 ELISA Kit

ELI-29587r 96 Tests
EUR 886

SOAT1 Conjugated Antibody

C38815 100ul
EUR 397

Anti-SOAT1 antibody

STJ28233 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the acyltransferase family. It is located in the endoplasmic reticulum, and catalyzes the formation of fatty acid-cholesterol esters. This gene has been implicated in the formation of beta-amyloid and atherosclerotic plaques by controlling the equilibrium between free cholesterol and cytoplasmic cholesteryl esters. Alternatively spliced transcript variants have been found for this gene.

Anti-SOAT1 antibody

STJ191474 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SOAT1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA14731 100 ul
EUR 403
Description: Rabbit polyclonal to SOAT1

SOAT1 Blocking Peptide

33R-1527 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SOAT1 antibody, catalog no. 70R-8626

SOAT1 Blocking Peptide

DF7778-BP 1mg
EUR 195

SOAT1 cloning plasmid

CSB-CL022385HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1653
  • Sequence: atggtgggtgaagagaagatgtctctaagaaaccggctgtcaaagtccagggaaaatcctgaggaagatgaagaccagagaaaccctgcaaaggagtccctagagacacctagtaatggtcgaattgacataaaacagttgatagcaaagaagataaagttgacagcagaggcag
  • Show more
Description: A cloning plasmid for the SOAT1 gene.

Mouse SOAT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat SOAT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SOAT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SOAT1 Recombinant Protein (Rat)

RP230426 100 ug Ask for price

SOAT1 Recombinant Protein (Human)

RP029665 100 ug Ask for price

SOAT1 Recombinant Protein (Mouse)

RP174425 100 ug Ask for price

Sterol O-Acyltransferase 1 (SOAT1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol O-Acyltransferase 1 (SOAT1) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol O-Acyltransferase 1 (SOAT1) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol O-Acyltransferase 1 (SOAT1) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Soat1 ORF Vector (Rat) (pORF)

ORF076810 1.0 ug DNA
EUR 506

SOAT1 ORF Vector (Human) (pORF)

ORF009889 1.0 ug DNA
EUR 95

Soat1 ORF Vector (Mouse) (pORF)

ORF058143 1.0 ug DNA
EUR 506

Soat1 sgRNA CRISPR Lentivector set (Rat)

K7034301 3 x 1.0 ug
EUR 339

Soat1 sgRNA CRISPR Lentivector set (Mouse)

K4820501 3 x 1.0 ug
EUR 339

SOAT1 sgRNA CRISPR Lentivector set (Human)

K2256701 3 x 1.0 ug
EUR 339

Soat1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7034302 1.0 ug DNA
EUR 154

Soat1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7034303 1.0 ug DNA
EUR 154

Soat1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7034304 1.0 ug DNA
EUR 154

Soat1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4820502 1.0 ug DNA
EUR 154

Soat1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4820503 1.0 ug DNA
EUR 154

Soat1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4820504 1.0 ug DNA
EUR 154

SOAT1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2256702 1.0 ug DNA
EUR 154

SOAT1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2256703 1.0 ug DNA
EUR 154

SOAT1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2256704 1.0 ug DNA
EUR 154

SOAT1 Protein Vector (Rat) (pPB-C-His)

PV307238 500 ng
EUR 603

SOAT1 Protein Vector (Rat) (pPB-N-His)

PV307239 500 ng
EUR 603

SOAT1 Protein Vector (Rat) (pPM-C-HA)

PV307240 500 ng
EUR 603

SOAT1 Protein Vector (Rat) (pPM-C-His)

PV307241 500 ng
EUR 603

SOAT1 Protein Vector (Human) (pPB-C-His)

PV039553 500 ng
EUR 329

SOAT1 Protein Vector (Human) (pPB-N-His)

PV039554 500 ng
EUR 329

SOAT1 Protein Vector (Human) (pPM-C-HA)

PV039555 500 ng
EUR 329

SOAT1 Protein Vector (Human) (pPM-C-His)

PV039556 500 ng
EUR 329

SOAT1 Protein Vector (Mouse) (pPB-C-His)

PV232570 500 ng
EUR 603

SOAT1 Protein Vector (Mouse) (pPB-N-His)

PV232571 500 ng
EUR 603

SOAT1 Protein Vector (Mouse) (pPM-C-HA)

PV232572 500 ng
EUR 603

SOAT1 Protein Vector (Mouse) (pPM-C-His)

PV232573 500 ng
EUR 603

Soat1 3'UTR Luciferase Stable Cell Line

TU119448 1.0 ml Ask for price

Soat1 3'UTR GFP Stable Cell Line

TU169448 1.0 ml Ask for price

Soat1 3'UTR Luciferase Stable Cell Line

TU220953 1.0 ml Ask for price

Soat1 3'UTR GFP Stable Cell Line

TU270953 1.0 ml Ask for price

SOAT1 3'UTR GFP Stable Cell Line

TU074298 1.0 ml
EUR 4617

SOAT1 3'UTR Luciferase Stable Cell Line

TU024298 1.0 ml
EUR 4617

Human Sterol-O-Acyltransferase 1 (SOAT1)ELISA Kit

201-12-2394 96 tests
EUR 440
  • This Sterol-O-Acyltransferase 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Sterol O- acyltransferase 1, SOAT1 ELISA KIT

ELI-19087h 96 Tests
EUR 824

Mouse Sterol O- acyltransferase 1, Soat1 ELISA KIT

ELI-30139m 96 Tests
EUR 865

SOAT1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV655765 1.0 ug DNA
EUR 682

SOAT1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV655769 1.0 ug DNA
EUR 682

SOAT1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV655770 1.0 ug DNA
EUR 682

SOAT1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV792907 1.0 ug DNA
EUR 316

SOAT1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV792908 1.0 ug DNA
EUR 316

Human Sterol-O-Acyltransferase 1(SOAT1)ELISA Kit

QY-E00341 96T
EUR 394

Rat Sterol-O-Acyltransferase 1(SOAT1)ELISA Kit

QY-E10475 96T
EUR 361

Mouse Sterol-O-Acyltransferase 1(SOAT1)ELISA Kit

QY-E21400 96T
EUR 361

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

SOAT1 Rabbit Polyclonal Antibody