Biocat Net

SOAT1 Rabbit pAb
A6311-100ul	Abclonal	100 ul	EUR 308

SOAT1 Rabbit pAb
A6311-200ul	Abclonal	200 ul	EUR 459

SOAT1 Rabbit pAb
A6311-20ul	Abclonal	20 ul	EUR 183

SOAT1 Rabbit pAb
A6311-50ul	Abclonal	50 ul	EUR 223

SOAT1 antibody
38815-100ul	SAB	100ul	EUR 252

SOAT1 Antibody
DF7778	Affbiotech	200ul	EUR 304
Description: SOAT1 Antibody detects endogenous levels of total SOAT1.

SOAT1 antibody
70R-8626	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal SOAT1 antibody

SOAT1 Antibody
1-CSB-PA022385DSR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SOAT1. Recognizes SOAT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

SOAT1 Antibody
1-CSB-PA022385DSR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SOAT1. Recognizes SOAT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SOAT1 Antibody
ABD7778	Lifescience Market	100 ug	EUR 438

SOAT1 Antibody
ABD7779	Lifescience Market	100 ug	EUR 438

Polyclonal SOAT1 antibody - middle region
APR10169G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SOAT1 - middle region. This antibody is tested and proven to work in the following applications:

Soat1/ Rat Soat1 ELISA Kit
ELI-29587r	Lifescience Market	96 Tests	EUR 886

SOAT1 Conjugated Antibody
C38815	SAB	100ul	EUR 397

Anti-SOAT1 antibody
STJ28233	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene belongs to the acyltransferase family. It is located in the endoplasmic reticulum, and catalyzes the formation of fatty acid-cholesterol esters. This gene has been implicated in the formation of beta-amyloid and atherosclerotic plaques by controlling the equilibrium between free cholesterol and cytoplasmic cholesteryl esters. Alternatively spliced transcript variants have been found for this gene.

Anti-SOAT1 antibody
STJ191474	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to SOAT1

SOAT1 siRNA
20-abx905198	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SOAT1 siRNA
20-abx934640	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SOAT1 siRNA
20-abx934641	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-SOAT1
YF-PA14731	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to SOAT1

SOAT1 Blocking Peptide
33R-1527	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SOAT1 antibody, catalog no. 70R-8626

SOAT1 Blocking Peptide
DF7778-BP	Affbiotech	1mg	EUR 195

SOAT1 cloning plasmid
CSB-CL022385HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1653 Sequence: atggtgggtgaagagaagatgtctctaagaaaccggctgtcaaagtccagggaaaatcctgaggaagatgaagaccagagaaaccctgcaaaggagtccctagagacacctagtaatggtcgaattgacataaaacagttgatagcaaagaagataaagttgacagcagaggcag Show more
Description: A cloning plasmid for the SOAT1 gene.

Mouse SOAT1 shRNA Plasmid
20-abx972814	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat SOAT1 shRNA Plasmid
20-abx986714	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human SOAT1 shRNA Plasmid
20-abx954526	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SOAT1 Recombinant Protein (Rat)
RP230426	ABM	100 ug	Ask for price

SOAT1 Recombinant Protein (Human)
RP029665	ABM	100 ug	Ask for price

SOAT1 Recombinant Protein (Mouse)
RP174425	ABM	100 ug	Ask for price

Sterol O-Acyltransferase 1 (SOAT1) Antibody
20-abx004824	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Sterol O-Acyltransferase 1 (SOAT1) Antibody
20-abx142236	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Sterol O-Acyltransferase 1 (SOAT1) Antibody
20-abx320400	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Sterol O-Acyltransferase 1 (SOAT1) Antibody
20-abx321595	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Soat1 ORF Vector (Rat) (pORF)
ORF076810	ABM	1.0 ug DNA	EUR 506

SOAT1 ORF Vector (Human) (pORF)
ORF009889	ABM	1.0 ug DNA	EUR 95

Soat1 ORF Vector (Mouse) (pORF)
ORF058143	ABM	1.0 ug DNA	EUR 506

Soat1 sgRNA CRISPR Lentivector set (Rat)
K7034301	ABM	3 x 1.0 ug	EUR 339

Soat1 sgRNA CRISPR Lentivector set (Mouse)
K4820501	ABM	3 x 1.0 ug	EUR 339

SOAT1 sgRNA CRISPR Lentivector set (Human)
K2256701	ABM	3 x 1.0 ug	EUR 339

Soat1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7034302	ABM	1.0 ug DNA	EUR 154

Soat1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7034303	ABM	1.0 ug DNA	EUR 154

Soat1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7034304	ABM	1.0 ug DNA	EUR 154

Soat1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4820502	ABM	1.0 ug DNA	EUR 154

Soat1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4820503	ABM	1.0 ug DNA	EUR 154

Soat1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4820504	ABM	1.0 ug DNA	EUR 154

SOAT1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2256702	ABM	1.0 ug DNA	EUR 154

SOAT1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2256703	ABM	1.0 ug DNA	EUR 154

SOAT1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2256704	ABM	1.0 ug DNA	EUR 154

SOAT1 Protein Vector (Rat) (pPB-C-His)
PV307238	ABM	500 ng	EUR 603

SOAT1 Protein Vector (Rat) (pPB-N-His)
PV307239	ABM	500 ng	EUR 603

SOAT1 Protein Vector (Rat) (pPM-C-HA)
PV307240	ABM	500 ng	EUR 603

SOAT1 Protein Vector (Rat) (pPM-C-His)
PV307241	ABM	500 ng	EUR 603

SOAT1 Protein Vector (Human) (pPB-C-His)
PV039553	ABM	500 ng	EUR 329

SOAT1 Protein Vector (Human) (pPB-N-His)
PV039554	ABM	500 ng	EUR 329

SOAT1 Protein Vector (Human) (pPM-C-HA)
PV039555	ABM	500 ng	EUR 329

SOAT1 Protein Vector (Human) (pPM-C-His)
PV039556	ABM	500 ng	EUR 329

SOAT1 Protein Vector (Mouse) (pPB-C-His)
PV232570	ABM	500 ng	EUR 603

SOAT1 Protein Vector (Mouse) (pPB-N-His)
PV232571	ABM	500 ng	EUR 603

SOAT1 Protein Vector (Mouse) (pPM-C-HA)
PV232572	ABM	500 ng	EUR 603

SOAT1 Protein Vector (Mouse) (pPM-C-His)
PV232573	ABM	500 ng	EUR 603

Soat1 3'UTR Luciferase Stable Cell Line
TU119448	ABM	1.0 ml	Ask for price

Soat1 3'UTR GFP Stable Cell Line
TU169448	ABM	1.0 ml	Ask for price

Soat1 3'UTR Luciferase Stable Cell Line
TU220953	ABM	1.0 ml	Ask for price

Soat1 3'UTR GFP Stable Cell Line
TU270953	ABM	1.0 ml	Ask for price

SOAT1 3'UTR GFP Stable Cell Line
TU074298	ABM	1.0 ml	EUR 4617

SOAT1 3'UTR Luciferase Stable Cell Line
TU024298	ABM	1.0 ml	EUR 4617

Human Sterol-O-Acyltransferase 1 (SOAT1)ELISA Kit
201-12-2394	SunredBio	96 tests	EUR 440
This Sterol-O-Acyltransferase 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Sterol O- acyltransferase 1, SOAT1 ELISA KIT
ELI-19087h	Lifescience Market	96 Tests	EUR 824

Mouse Sterol O- acyltransferase 1, Soat1 ELISA KIT
ELI-30139m	Lifescience Market	96 Tests	EUR 865

SOAT1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV655765	ABM	1.0 ug DNA	EUR 682

SOAT1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV655769	ABM	1.0 ug DNA	EUR 682

SOAT1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV655770	ABM	1.0 ug DNA	EUR 682

SOAT1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV792907	ABM	1.0 ug DNA	EUR 316

SOAT1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV792908	ABM	1.0 ug DNA	EUR 316

Human Sterol-O-Acyltransferase 1(SOAT1)ELISA Kit
QY-E00341	Qayee Biotechnology	96T	EUR 394

Rat Sterol-O-Acyltransferase 1(SOAT1)ELISA Kit
QY-E10475	Qayee Biotechnology	96T	EUR 361

Mouse Sterol-O-Acyltransferase 1(SOAT1)ELISA Kit
QY-E21400	Qayee Biotechnology	96T	EUR 361

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

SOAT1 Rabbit Polyclonal Antibody