SOCS4 Rabbit Polyclonal Antibody

SOCS4 Polyclonal Antibody

ABP60459-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SOCS4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SOCS4 from Human, Mouse. This SOCS4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SOCS4 protein

SOCS4 Polyclonal Antibody

ABP60459-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SOCS4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SOCS4 from Human, Mouse. This SOCS4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SOCS4 protein

SOCS4 Polyclonal Antibody

ES10319-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SOCS4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SOCS4 Polyclonal Antibody

ES10319-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SOCS4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SOCS4 Rabbit pAb

A8003-100ul 100 ul
EUR 308

SOCS4 Rabbit pAb

A8003-200ul 200 ul
EUR 459

SOCS4 Rabbit pAb

A8003-20ul 20 ul
EUR 183

SOCS4 Rabbit pAb

A8003-50ul 50 ul
EUR 223

Polyclonal SOCS4 Antibody (Center)

AMM07931G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SOCS4 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal SOCS4 Antibody (Center)

AMM07932G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SOCS4 (Center). This antibody is tested and proven to work in the following applications:

SOCS4 Polyclonal Conjugated Antibody

C31412 100ul
EUR 397

SOCS4 antibody

22880-100ul 100ul
EUR 390

SOCS4 antibody

70R-12835 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal SOCS4 antibody

SOCS4 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SOCS4. Recognizes SOCS4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

SOCS4 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SOCS4. Recognizes SOCS4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

Polyclonal SOCS4 Antibody (C-Term)

AMM07929G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SOCS4 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal SOCS4 Antibody (C-Terminus)

AMM07930G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SOCS4 (C-Terminus). This antibody is tested and proven to work in the following applications:

Anti-SOCS4 Antibody

PB9506 100ug/vial
EUR 294

Anti-SOCS4 antibody

STJ110310 100 µl
EUR 277
Description: The protein encoded by this gene contains a SH2 domain and a SOCS BOX domain. The protein thus belongs to the suppressor of cytokine signaling (SOCS), also known as STAT-induced STAT inhibitor (SSI), protein family. SOCS family members are known to be cytokine-inducible negative regulators of cytokine signaling. Two alternatively spliced transcript variants encoding the same protein have been found for this gene.

Anti-SOCS4 antibody

STJ191477 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SOCS4

Anti-SOCS4 antibody

STJ70134 100 µg
EUR 359


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA22056 50 ug
EUR 363
Description: Mouse polyclonal to SOCS4


YF-PA22057 100 ug
EUR 403
Description: Rabbit polyclonal to SOCS4

SOCS4 cloning plasmid

CSB-CL022393HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1323
  • Sequence: atggcagaaaataatgaaaatattagtaaaaatgtagatgtaaggcccaaaactagtcggagcagaagtgccgacagaaaagacggttatgtgtggagtggaaagaagttatcttggtcaaaaaagagtgagagttattcagatgctgagacagtgaatggtatagagaaaaccg
  • Show more
Description: A cloning plasmid for the SOCS4 gene.

Anti-SOCS4 (2G8)

YF-MA19795 100 ug
EUR 363
Description: Mouse monoclonal to SOCS4


EF007284 96 Tests
EUR 689

Mouse SOCS4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SOCS4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SOCS4 Recombinant Protein (Rat)

RP230444 100 ug Ask for price

SOCS4 Recombinant Protein (Human)

RP029674 100 ug Ask for price

SOCS4 Recombinant Protein (Mouse)

RP174452 100 ug Ask for price

Monoclonal SOCS4 Antibody (monoclonal) (M01), Clone: 2G8

AMM07933G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human SOCS4 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2G8. This antibody is applicable in WB, E

Suppressor of Cytokine Signaling 4 (SOCS4) Antibody

abx026472-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Suppressor of Cytokine Signaling 4 (SOCS4) Antibody

abx026472-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Suppressor of Cytokine Signaling 4 (SOCS4) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Suppressor of Cytokine Signaling 4 (SOCS4) Antibody

abx028133-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Suppressor of Cytokine Signaling 4 (SOCS4) Antibody

abx028133-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Suppressor of Cytokine Signaling 4 (SOCS4) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Suppressor of Cytokine Signaling 4 (SOCS4) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Suppressor of Cytokine Signaling 4 (SOCS4) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Suppressor of Cytokine Signaling 4 (SOCS4) Antibody

abx433299-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Socs4 ORF Vector (Rat) (pORF)

ORF076816 1.0 ug DNA
EUR 506

SOCS4 ORF Vector (Human) (pORF)

ORF009892 1.0 ug DNA
EUR 95

Socs4 ORF Vector (Mouse) (pORF)

ORF058152 1.0 ug DNA
EUR 506

SOCS4 ELISA Kit (Human) (OKWB00191)

OKWB00191 96 Wells
EUR 572
Description: Description of target: SOCS family proteins form part of a classical negative feedback system that regulates cytokine signal transduction. Substrate-recognition component of a SCF-like ECS (Elongin BC-CUL2/5-SOCS-box protein) E3 ubiquitin-protein ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. Inhibits EGF signaling by mediating the degradation of the Tyr-phosphorylated EGF receptor/EGFR.;Species reactivity: Human;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 2.3 pg/mL

Socs4 sgRNA CRISPR Lentivector set (Rat)

K6730201 3 x 1.0 ug
EUR 339

SOCS4 sgRNA CRISPR Lentivector set (Human)

K2257401 3 x 1.0 ug
EUR 339

Socs4 sgRNA CRISPR Lentivector set (Mouse)

K4035401 3 x 1.0 ug
EUR 339

Socs4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6730202 1.0 ug DNA
EUR 154

Socs4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6730203 1.0 ug DNA
EUR 154

Socs4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6730204 1.0 ug DNA
EUR 154

SOCS4 sgRNA CRISPR Lentivector (Human) (Target 1)

K2257402 1.0 ug DNA
EUR 154

SOCS4 sgRNA CRISPR Lentivector (Human) (Target 2)

K2257403 1.0 ug DNA
EUR 154

SOCS4 sgRNA CRISPR Lentivector (Human) (Target 3)

K2257404 1.0 ug DNA
EUR 154

Socs4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4035402 1.0 ug DNA
EUR 154

Socs4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4035403 1.0 ug DNA
EUR 154

Socs4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4035404 1.0 ug DNA
EUR 154

SOCS4 Protein Vector (Rat) (pPB-C-His)

PV307262 500 ng
EUR 603

SOCS4 Protein Vector (Rat) (pPB-N-His)

PV307263 500 ng
EUR 603

SOCS4 Protein Vector (Rat) (pPM-C-HA)

PV307264 500 ng
EUR 603

SOCS4 Protein Vector (Rat) (pPM-C-His)

PV307265 500 ng
EUR 603

SOCS4 Protein Vector (Human) (pPB-C-His)

PV039565 500 ng
EUR 329

SOCS4 Protein Vector (Human) (pPB-N-His)

PV039566 500 ng
EUR 329

SOCS4 Protein Vector (Human) (pPM-C-HA)

PV039567 500 ng
EUR 329

SOCS4 Protein Vector (Human) (pPM-C-His)

PV039568 500 ng
EUR 329

SOCS4 Protein Vector (Mouse) (pPB-C-His)

PV232606 500 ng
EUR 603

SOCS4 Protein Vector (Mouse) (pPB-N-His)

PV232607 500 ng
EUR 603

SOCS4 Protein Vector (Mouse) (pPM-C-HA)

PV232608 500 ng
EUR 603

SOCS4 Protein Vector (Mouse) (pPM-C-His)

PV232609 500 ng
EUR 603

Socs4 3'UTR Luciferase Stable Cell Line

TU119454 1.0 ml Ask for price

Socs4 3'UTR GFP Stable Cell Line

TU169454 1.0 ml Ask for price

Socs4 3'UTR Luciferase Stable Cell Line

TU220958 1.0 ml Ask for price

Socs4 3'UTR GFP Stable Cell Line

TU270958 1.0 ml Ask for price

SOCS4 3'UTR GFP Stable Cell Line

TU074306 1.0 ml
EUR 4617

SOCS4 3'UTR Luciferase Stable Cell Line

TU024306 1.0 ml
EUR 4617

SOCS4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV624079 1.0 ug DNA
EUR 682

SOCS4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV624083 1.0 ug DNA
EUR 682

SOCS4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV624084 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

SOCS4 Rabbit Polyclonal Antibody