SOCS4 Polyclonal Antibody |
ABP60459-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human SOCS4 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SOCS4 from Human, Mouse. This SOCS4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SOCS4 protein |
SOCS4 Polyclonal Antibody |
ABP60459-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human SOCS4 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SOCS4 from Human, Mouse. This SOCS4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SOCS4 protein |
SOCS4 Polyclonal Antibody |
31412-100ul |
SAB |
100ul |
EUR 252 |
SOCS4 Polyclonal Antibody |
31412-50ul |
SAB |
50ul |
EUR 187 |
SOCS4 Rabbit pAb |
A8003-100ul |
Abclonal |
100 ul |
EUR 308 |
SOCS4 Rabbit pAb |
A8003-200ul |
Abclonal |
200 ul |
EUR 459 |
SOCS4 Rabbit pAb |
A8003-20ul |
Abclonal |
20 ul |
EUR 183 |
SOCS4 Rabbit pAb |
A8003-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal SOCS4 Antibody (Center) |
AMM07931G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SOCS4 (Center). This antibody is tested and proven to work in the following applications: |
Polyclonal SOCS4 Antibody (Center) |
AMM07932G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SOCS4 (Center). This antibody is tested and proven to work in the following applications: |
SOCS4 Polyclonal Conjugated Antibody |
C31412 |
SAB |
100ul |
EUR 397 |
SOCS4 antibody |
22880-100ul |
SAB |
100ul |
EUR 390 |
SOCS4 antibody |
70R-12835 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal SOCS4 antibody |
SOCS4 Antibody |
1-CSB-PA022393ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against SOCS4. Recognizes SOCS4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
SOCS4 Antibody |
1-CSB-PA022393ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against SOCS4. Recognizes SOCS4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
Polyclonal SOCS4 Antibody (C-Term) |
AMM07929G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SOCS4 (C-Term). This antibody is tested and proven to work in the following applications: |
Polyclonal SOCS4 Antibody (C-Terminus) |
AMM07930G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SOCS4 (C-Terminus). This antibody is tested and proven to work in the following applications: |
Anti-SOCS4 Antibody |
PB9506 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-SOCS4 antibody |
STJ110310 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene contains a SH2 domain and a SOCS BOX domain. The protein thus belongs to the suppressor of cytokine signaling (SOCS), also known as STAT-induced STAT inhibitor (SSI), protein family. SOCS family members are known to be cytokine-inducible negative regulators of cytokine signaling. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. |
Anti-SOCS4 antibody |
STJ191477 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to SOCS4 |
SOCS4 siRNA |
20-abx934652 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SOCS4 siRNA |
20-abx934653 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-SOCS4 |
YF-PA22056 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to SOCS4 |
anti-SOCS4 |
YF-PA22057 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to SOCS4 |
SOCS4 cloning plasmid |
CSB-CL022393HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1323
- Sequence: atggcagaaaataatgaaaatattagtaaaaatgtagatgtaaggcccaaaactagtcggagcagaagtgccgacagaaaagacggttatgtgtggagtggaaagaagttatcttggtcaaaaaagagtgagagttattcagatgctgagacagtgaatggtatagagaaaaccg
- Show more
|
Description: A cloning plasmid for the SOCS4 gene. |
Anti-SOCS4 (2G8) |
YF-MA19795 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to SOCS4 |
Mouse SOCS4 shRNA Plasmid |
20-abx976085 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human SOCS4 shRNA Plasmid |
20-abx964712 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SOCS4 Recombinant Protein (Human) |
RP029674 |
ABM |
100 ug |
Ask for price |
SOCS4 Recombinant Protein (Rat) |
RP230444 |
ABM |
100 ug |
Ask for price |
SOCS4 Recombinant Protein (Mouse) |
RP174452 |
ABM |
100 ug |
Ask for price |
Monoclonal SOCS4 Antibody (monoclonal) (M01), Clone: 2G8 |
AMM07933G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human SOCS4 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2G8. This antibody is applicable in WB, E |
Suppressor of Cytokine Signaling 4 (SOCS4) Antibody |
20-abx142237 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Suppressor of Cytokine Signaling 4 (SOCS4) Antibody |
20-abx005669 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Suppressor of Cytokine Signaling 4 (SOCS4) Antibody |
abx026472-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Suppressor of Cytokine Signaling 4 (SOCS4) Antibody |
abx026472-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Suppressor of Cytokine Signaling 4 (SOCS4) Antibody |
abx028133-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Suppressor of Cytokine Signaling 4 (SOCS4) Antibody |
abx028133-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Suppressor of Cytokine Signaling 4 (SOCS4) Antibody |
20-abx322555 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Suppressor of Cytokine Signaling 4 (SOCS4) Antibody |
20-abx322556 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Suppressor of Cytokine Signaling 4 (SOCS4) Antibody |
abx433299-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Socs4 ORF Vector (Mouse) (pORF) |
ORF058152 |
ABM |
1.0 ug DNA |
EUR 506 |
SOCS4 ORF Vector (Human) (pORF) |
ORF009892 |
ABM |
1.0 ug DNA |
EUR 95 |
Socs4 ORF Vector (Rat) (pORF) |
ORF076816 |
ABM |
1.0 ug DNA |
EUR 506 |
SOCS4 sgRNA CRISPR Lentivector set (Human) |
K2257401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Socs4 sgRNA CRISPR Lentivector set (Mouse) |
K4035401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Socs4 sgRNA CRISPR Lentivector set (Rat) |
K6730201 |
ABM |
3 x 1.0 ug |
EUR 339 |
SOCS4 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2257402 |
ABM |
1.0 ug DNA |
EUR 154 |
SOCS4 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2257403 |
ABM |
1.0 ug DNA |
EUR 154 |
SOCS4 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2257404 |
ABM |
1.0 ug DNA |
EUR 154 |
Socs4 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4035402 |
ABM |
1.0 ug DNA |
EUR 154 |
Socs4 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4035403 |
ABM |
1.0 ug DNA |
EUR 154 |
Socs4 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4035404 |
ABM |
1.0 ug DNA |
EUR 154 |
Socs4 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6730202 |
ABM |
1.0 ug DNA |
EUR 154 |
Socs4 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6730203 |
ABM |
1.0 ug DNA |
EUR 154 |
Socs4 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6730204 |
ABM |
1.0 ug DNA |
EUR 154 |
SOCS4 Protein Vector (Human) (pPB-C-His) |
PV039565 |
ABM |
500 ng |
EUR 329 |
SOCS4 Protein Vector (Human) (pPB-N-His) |
PV039566 |
ABM |
500 ng |
EUR 329 |
SOCS4 Protein Vector (Human) (pPM-C-HA) |
PV039567 |
ABM |
500 ng |
EUR 329 |
SOCS4 Protein Vector (Human) (pPM-C-His) |
PV039568 |
ABM |
500 ng |
EUR 329 |
SOCS4 Protein Vector (Rat) (pPB-C-His) |
PV307262 |
ABM |
500 ng |
EUR 603 |
SOCS4 Protein Vector (Rat) (pPB-N-His) |
PV307263 |
ABM |
500 ng |
EUR 603 |
SOCS4 Protein Vector (Rat) (pPM-C-HA) |
PV307264 |
ABM |
500 ng |
EUR 603 |
SOCS4 Protein Vector (Rat) (pPM-C-His) |
PV307265 |
ABM |
500 ng |
EUR 603 |
SOCS4 Protein Vector (Mouse) (pPB-C-His) |
PV232606 |
ABM |
500 ng |
EUR 603 |
SOCS4 Protein Vector (Mouse) (pPB-N-His) |
PV232607 |
ABM |
500 ng |
EUR 603 |
SOCS4 Protein Vector (Mouse) (pPM-C-HA) |
PV232608 |
ABM |
500 ng |
EUR 603 |
SOCS4 Protein Vector (Mouse) (pPM-C-His) |
PV232609 |
ABM |
500 ng |
EUR 603 |
Socs4 3'UTR GFP Stable Cell Line |
TU169454 |
ABM |
1.0 ml |
Ask for price |
Socs4 3'UTR Luciferase Stable Cell Line |
TU119454 |
ABM |
1.0 ml |
Ask for price |
SOCS4 3'UTR GFP Stable Cell Line |
TU074306 |
ABM |
1.0 ml |
EUR 4617 |
SOCS4 3'UTR Luciferase Stable Cell Line |
TU024306 |
ABM |
1.0 ml |
EUR 4617 |
Socs4 3'UTR Luciferase Stable Cell Line |
TU220958 |
ABM |
1.0 ml |
Ask for price |
Socs4 3'UTR GFP Stable Cell Line |
TU270958 |
ABM |
1.0 ml |
Ask for price |
SOCS4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV624079 |
ABM |
1.0 ug DNA |
EUR 682 |
SOCS4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV624083 |
ABM |
1.0 ug DNA |
EUR 682 |
SOCS4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV624084 |
ABM |
1.0 ug DNA |
EUR 682 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
SOCS4 Rabbit Polyclonal Antibody