Biocat Net

SPDEF Polyclonal Antibody
ES10192-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against SPDEF from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SPDEF Rabbit pAb
A14114-100ul	Abclonal	100 ul	EUR 308

SPDEF Rabbit pAb
A14114-200ul	Abclonal	200 ul	EUR 459

SPDEF Rabbit pAb
A14114-20ul	Abclonal	20 ul	EUR 183

SPDEF Rabbit pAb
A14114-50ul	Abclonal	50 ul	EUR 223

SPDEF Rabbit pAb
A6747-100ul	Abclonal	100 ul	EUR 308

SPDEF Rabbit pAb
A6747-200ul	Abclonal	200 ul	EUR 459

SPDEF Rabbit pAb
A6747-20ul	Abclonal	20 ul	EUR 183

SPDEF Rabbit pAb
A6747-50ul	Abclonal	50 ul	EUR 223

SPDEF Antibody
35874-100ul	SAB	100ul	EUR 252

SPDEF Antibody
1-CSB-PA874773	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SPDEF. Recognizes SPDEF from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

SPDEF antibody
70R-8298	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal SPDEF antibody

SPDEF Antibody
1-CSB-PA022518LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPDEF. Recognizes SPDEF from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

Polyclonal SPDEF antibody - middle region
APR00614G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SPDEF - middle region. This antibody is tested and proven to work in the following applications:

Polyclonal SPDEF antibody - N-terminal region
APR00593G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SPDEF - N-terminal region. This antibody is tested and proven to work in the following applications:

SPDEF Conjugated Antibody
C35874	SAB	100ul	EUR 397

Anti-SPDEF antibody
STJ28830	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene belongs to the ETS family of transcription factors. It is highly expressed in the prostate epithelial cells, and functions as an androgen-independent transactivator of prostate-specific antigen (PSA) promoter. Higher expression of this protein has also been reported in brain, breast, lung and ovarian tumors, compared to the corresponding normal tissues, and it shows better tumor-association than other cancer-associated molecules, making it a more suitable target for developing specific cancer therapies. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-SPDEF antibody
STJ116049	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene belongs to the ETS family of transcription factors. It is highly expressed in the prostate epithelial cells, and functions as an androgen-independent transactivator of prostate-specific antigen (PSA) promoter. Higher expression of this protein has also been reported in brain, breast, lung and ovarian tumors, compared to the corresponding normal tissues, and it shows better tumor-association than other cancer-associated molecules, making it a more suitable target for developing specific cancer therapies. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-SPDEF antibody
STJ191350	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to SPDEF

SPDEF siRNA
20-abx934902	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SPDEF siRNA
20-abx934903	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-SPDEF
YF-PA25935	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to SPDEF

SPDEF Antibody, HRP conjugated
1-CSB-PA022518LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPDEF. Recognizes SPDEF from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SPDEF Antibody, FITC conjugated
1-CSB-PA022518LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPDEF. Recognizes SPDEF from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SPDEF Antibody, Biotin conjugated
1-CSB-PA022518LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPDEF. Recognizes SPDEF from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SPDEF Blocking Peptide
33R-2949	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SPDEF antibody, catalog no. 70R-8298

SPDEF cloning plasmid
CSB-CL022518HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1008 Sequence: atgggcagcgccagcccgggtctgagcagcgtatcccccagccacctcctgctgccccccgacacggtgtcgcggacaggcttggagaaggcggcagcgggggcagtgggtctcgagagacgggactggagtcccagtccacccgccacgcccgagcagggcctgtccgccttct Show more
Description: A cloning plasmid for the SPDEF gene.

Anti-SPDEF (4A5)
YF-MA18002	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to SPDEF

SPDEF ELISA KIT|Human
EF005474	Lifescience Market	96 Tests	EUR 689

Human SPDEF ELISA KIT
ELI-52217h	Lifescience Market	96 Tests	EUR 824

Mouse Spdef ELISA KIT
ELI-42551m	Lifescience Market	96 Tests	EUR 865

Mouse SPDEF shRNA Plasmid
20-abx974014	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human SPDEF shRNA Plasmid
20-abx958507	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SPDEF Recombinant Protein (Rat)
RP230720	ABM	100 ug	Ask for price

SPDEF Recombinant Protein (Human)
RP029854	ABM	100 ug	Ask for price

SPDEF Recombinant Protein (Mouse)
RP174884	ABM	100 ug	Ask for price

Monoclonal SPDEF Antibody (monoclonal) (M01), Clone: 4A5
AMM04127G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human SPDEF (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4A5. This antibody is applicable in WB, E

Spdef ORF Vector (Rat) (pORF)
ORF076908	ABM	1.0 ug DNA	EUR 506

SPDEF ORF Vector (Human) (pORF)
ORF009952	ABM	1.0 ug DNA	EUR 95

Spdef ORF Vector (Mouse) (pORF)
ORF058296	ABM	1.0 ug DNA	EUR 506

pENTR223-SPDEF-599G-C997 vector
PVT11948	Lifescience Market	2 ug	EUR 308

Spdef sgRNA CRISPR Lentivector set (Rat)
K6696201	ABM	3 x 1.0 ug	EUR 339

Spdef sgRNA CRISPR Lentivector set (Mouse)
K3873401	ABM	3 x 1.0 ug	EUR 339

SPDEF sgRNA CRISPR Lentivector set (Human)
K2269901	ABM	3 x 1.0 ug	EUR 339

SAM Pointed Domain-Containing Ets Transcription Factor (SPDEF) Antibody
20-abx006389	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

SAM pointed domain-containing Ets transcription factor (SPDEF) Antibody
20-abx212939	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

SAM Pointed Domain-Containing Ets Transcription Factor (SPDEF) Antibody
abx145115-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

SAM Pointed Domain-Containing Ets Transcription Factor (SPDEF) Antibody
20-abx317850	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Spdef sgRNA CRISPR Lentivector (Rat) (Target 1)
K6696202	ABM	1.0 ug DNA	EUR 154

Spdef sgRNA CRISPR Lentivector (Rat) (Target 2)
K6696203	ABM	1.0 ug DNA	EUR 154

Spdef sgRNA CRISPR Lentivector (Rat) (Target 3)
K6696204	ABM	1.0 ug DNA	EUR 154

Spdef sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3873402	ABM	1.0 ug DNA	EUR 154

Spdef sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3873403	ABM	1.0 ug DNA	EUR 154

Spdef sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3873404	ABM	1.0 ug DNA	EUR 154

SPDEF sgRNA CRISPR Lentivector (Human) (Target 1)
K2269902	ABM	1.0 ug DNA	EUR 154

SPDEF sgRNA CRISPR Lentivector (Human) (Target 2)
K2269903	ABM	1.0 ug DNA	EUR 154

SPDEF sgRNA CRISPR Lentivector (Human) (Target 3)
K2269904	ABM	1.0 ug DNA	EUR 154

SPDEF Protein Vector (Rat) (pPB-C-His)
PV307630	ABM	500 ng	EUR 603

SPDEF Protein Vector (Rat) (pPB-N-His)
PV307631	ABM	500 ng	EUR 603

SPDEF Protein Vector (Rat) (pPM-C-HA)
PV307632	ABM	500 ng	EUR 603

SPDEF Protein Vector (Rat) (pPM-C-His)
PV307633	ABM	500 ng	EUR 603

SPDEF Protein Vector (Human) (pPB-C-His)
PV039805	ABM	500 ng	EUR 329

SPDEF Protein Vector (Human) (pPB-N-His)
PV039806	ABM	500 ng	EUR 329

SPDEF Protein Vector (Human) (pPM-C-HA)
PV039807	ABM	500 ng	EUR 329

SPDEF Protein Vector (Human) (pPM-C-His)
PV039808	ABM	500 ng	EUR 329

SPDEF Protein Vector (Mouse) (pPB-C-His)
PV233182	ABM	500 ng	EUR 603

SPDEF Protein Vector (Mouse) (pPB-N-His)
PV233183	ABM	500 ng	EUR 603

SPDEF Protein Vector (Mouse) (pPM-C-HA)
PV233184	ABM	500 ng	EUR 603

SPDEF Protein Vector (Mouse) (pPM-C-His)
PV233185	ABM	500 ng	EUR 603

Spdef 3'UTR Luciferase Stable Cell Line
TU119556	ABM	1.0 ml	Ask for price

Spdef 3'UTR GFP Stable Cell Line
TU169556	ABM	1.0 ml	Ask for price

Spdef 3'UTR Luciferase Stable Cell Line
TU221056	ABM	1.0 ml	Ask for price

SPDEF 3'UTR GFP Stable Cell Line
TU074433	ABM	1.0 ml	EUR 1394

Spdef 3'UTR GFP Stable Cell Line
TU271056	ABM	1.0 ml	Ask for price

SPDEF 3'UTR Luciferase Stable Cell Line
TU024433	ABM	1.0 ml	EUR 1394

SAM Pointed Domain-Containing Ets Transcription Factor (SPDEF) Antibody (HRP)
20-abx314344	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

SAM Pointed Domain-Containing Ets Transcription Factor (SPDEF) Antibody (FITC)
20-abx314345	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

SAM Pointed Domain-Containing Ets Transcription Factor (SPDEF) Antibody (Biotin)
20-abx314346	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

SPDEF Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV623065	ABM	1.0 ug DNA	EUR 514

SPDEF Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV623069	ABM	1.0 ug DNA	EUR 514

SPDEF Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV623070	ABM	1.0 ug DNA	EUR 514

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

SPDEF Rabbit Polyclonal Antibody