STK25 Rabbit Polyclonal Antibody

STK25 Polyclonal Antibody

ABP60540-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human STK25 protein at amino acid sequence of 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of STK25 from Human, Mouse. This STK25 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK25 protein at amino acid sequence of 170-250

STK25 Polyclonal Antibody

A54396 100 µg
EUR 570.55
Description: The best epigenetics products

STK25 Polyclonal Antibody

31735-100ul 100ul
EUR 252

STK25 Polyclonal Antibody

31735-50ul 50ul
EUR 187

STK25 Rabbit pAb

A9726-100ul 100 ul
EUR 308

STK25 Rabbit pAb

A9726-200ul 200 ul
EUR 459

STK25 Rabbit pAb

A9726-20ul 20 ul
EUR 183

STK25 Rabbit pAb

A9726-50ul 50 ul
EUR 223

STK25 Polyclonal Conjugated Antibody

C31735 100ul
EUR 397

STK25 Antibody

ABD9883 100 ug
EUR 438

Stk25 antibody

70R-8797 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Stk25 antibody

STK25 antibody

22448-100ul 100ul
EUR 390

STK25 antibody

70R-13091 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal STK25 antibody

STK25 Antibody

DF9883 200ul
EUR 304
Description: STK25 Antibody detects endogenous levels of total STK25.

STK25 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STK25. Recognizes STK25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Polyclonal STK25 Antibody (C-term)

APR10930G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STK25 (C-term). This antibody is tested and proven to work in the following applications:

STK25 Polyclonal Antibody, Biotin Conjugated

A54393 100 µg
EUR 570.55
Description: Ask the seller for details

STK25 Polyclonal Antibody, FITC Conjugated

A54394 100 µg
EUR 570.55
Description: The best epigenetics products

STK25 Polyclonal Antibody, HRP Conjugated

A54395 100 µg
EUR 570.55
Description: kits suitable for this type of research

anti- STK25 antibody

FNab08328 100µg
EUR 585
  • Immunogen: serine/threonine kinase 25(STE20 homolog, yeast)
  • Uniprot ID: O00506
  • Gene ID: 10494
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against STK25

Mouse Stk25 Antibody

abx028074-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mouse Stk25 Antibody

abx028074-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Anti-STK25 antibody

PAab08328 100 ug
EUR 412

Anti-STK25 antibody

STJ111804 100 µl
EUR 277
Description: This gene encodes a member of the germinal centre kinase III (GCK III) subfamily of the sterile 20 superfamily of kinases. The encoded enzyme plays a role in serine-threonine liver kinase B1 (LKB1) signaling pathway to regulate neuronal polarization and morphology of the Golgi apparatus. The protein is translocated from the Golgi apparatus to the nucleus in response to chemical anoxia and plays a role in regulation of cell death. A pseudogene associated with this gene is located on chromosome 18. Multiple alternatively spliced transcript variants have been observed for this gene.

Anti-STK25 antibody

STJ191358 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to STK25


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA17007 50 ul
EUR 363
Description: Mouse polyclonal to STK25


YF-PA17008 100 ug
EUR 403
Description: Rabbit polyclonal to STK25

STK25 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STK25. Recognizes STK25 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

STK25 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STK25. Recognizes STK25 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

STK25 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STK25. Recognizes STK25 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

STK25 cloning plasmid

CSB-CL022842HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1281
  • Sequence: atggctcacctccggggatttgccaaccagcactctcgagtggaccctgaggagctcttcaccaagctcgaccgcattggcaagggctcgtttggggaggtctacaagggcatcgataaccacacaaaggaggtggtggccatcaagatcatcgacctggaggaggccgaggatg
  • Show more
Description: A cloning plasmid for the STK25 gene.

STK25 cloning plasmid

CSB-CL022842HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1281
  • Sequence: atggctcacctccggggatttgccaaccagcactctcgagtggaccctgaggagctcttcaccaagctcgaccgcattggcaagggctcgtttggggaggtctacaagggcatcgataaccacacaaaggaggtggtggccatcaagatcatcgacctggaggaggccgaggatg
  • Show more
Description: A cloning plasmid for the STK25 gene.

Stk25 Blocking Peptide

33R-9142 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Stk25 antibody, catalog no. 70R-8797

STK25 Blocking Peptide

DF9883-BP 1mg
EUR 195

anti-STK25 (1G6)

LF-MA10320 100 ug
EUR 363
Description: Mouse monoclonal to STK25

Anti-STK25 (4B10)

YF-MA17339 100 ug
EUR 363
Description: Mouse monoclonal to STK25

Mouse STK25 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF003307 96 Tests
EUR 689

Human STK25 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

STK25 Recombinant Protein (Human)

RP030412 100 ug Ask for price

STK25 Recombinant Protein (Human)

RP030415 100 ug Ask for price

STK25 Recombinant Protein (Rat)

RP231458 100 ug Ask for price

STK25 Recombinant Protein (Mouse)

RP176060 100 ug Ask for price

pCMV-SPORT6.1-STK25 Plasmid

PVT16016 2 ug
EUR 325

Serine/Threonine Kinase 25 (STK25) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine/Threonine Kinase 25 (STK25) Antibody

abx145678-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Serine/Threonine Kinase 25 (STK25) Antibody

abx034689-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serine/Threonine Kinase 25 (STK25) Antibody

abx034689-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Serine/Threonine Kinase 25 (STK25) Antibody

abx238328-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Serine/threonine-Protein Kinase 25 (STK25) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serine/Threonine-Protein Kinase 25 (STK25) Antibody

abx033788-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serine/Threonine-Protein Kinase 25 (STK25) Antibody

abx033788-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

h STK25 inducible lentiviral particles

LVP246 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, STK25, is fully sequence verified and matched to NCBI accession ID: NM_006374

Stk25 ORF Vector (Mouse) (pORF)

ORF058688 1.0 ug DNA
EUR 506

STK25 ORF Vector (Human) (pORF)

ORF010138 1.0 ug DNA
EUR 95

STK25 ORF Vector (Human) (pORF)

ORF010139 1.0 ug DNA
EUR 95

Stk25 ORF Vector (Rat) (pORF)

ORF077154 1.0 ug DNA
EUR 506

STK25 sgRNA CRISPR Lentivector set (Human)

K2303701 3 x 1.0 ug
EUR 339

Stk25 sgRNA CRISPR Lentivector set (Mouse)

K3817601 3 x 1.0 ug
EUR 339

Stk25 sgRNA CRISPR Lentivector set (Rat)

K7599901 3 x 1.0 ug
EUR 339

STK25 sgRNA CRISPR Lentivector (Human) (Target 1)

K2303702 1.0 ug DNA
EUR 154

STK25 sgRNA CRISPR Lentivector (Human) (Target 2)

K2303703 1.0 ug DNA
EUR 154

STK25 sgRNA CRISPR Lentivector (Human) (Target 3)

K2303704 1.0 ug DNA
EUR 154

Human Serine/threonine-protein kinase 25 (STK25)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 64.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Serine/threonine-protein kinase 25(STK25) expressed in E.coli

Stk25 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3817602 1.0 ug DNA
EUR 154

Stk25 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3817603 1.0 ug DNA
EUR 154

Stk25 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3817604 1.0 ug DNA
EUR 154

Stk25 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7599902 1.0 ug DNA
EUR 154

Stk25 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7599903 1.0 ug DNA
EUR 154

Stk25 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7599904 1.0 ug DNA
EUR 154

STK25 Protein Vector (Human) (pPB-C-His)

PV040549 500 ng
EUR 329

STK25 Protein Vector (Human) (pPB-N-His)

PV040550 500 ng
EUR 329

STK25 Protein Vector (Human) (pPM-C-HA)

PV040551 500 ng
EUR 329

STK25 Protein Vector (Human) (pPM-C-His)

PV040552 500 ng
EUR 329

STK25 Protein Vector (Human) (pPB-C-His)

PV040553 500 ng
EUR 329

STK25 Protein Vector (Human) (pPB-N-His)

PV040554 500 ng
EUR 329

STK25 Protein Vector (Human) (pPM-C-HA)

PV040555 500 ng
EUR 329

STK25 Protein Vector (Human) (pPM-C-His)

PV040556 500 ng
EUR 329

STK25 Protein Vector (Rat) (pPB-C-His)

PV308614 500 ng
EUR 603

STK25 Protein Vector (Rat) (pPB-N-His)

PV308615 500 ng
EUR 603

STK25 Protein Vector (Rat) (pPM-C-HA)

PV308616 500 ng
EUR 603

STK25 Protein Vector (Rat) (pPM-C-His)

PV308617 500 ng
EUR 603

STK25 Protein Vector (Mouse) (pPB-C-His)

PV234750 500 ng
EUR 603

STK25 Protein Vector (Mouse) (pPB-N-His)

PV234751 500 ng
EUR 603

STK25 Protein Vector (Mouse) (pPM-C-HA)

PV234752 500 ng
EUR 603

STK25 Protein Vector (Mouse) (pPM-C-His)

PV234753 500 ng
EUR 603

Stk25 3'UTR GFP Stable Cell Line

TU169846 1.0 ml Ask for price

Stk25 3'UTR Luciferase Stable Cell Line

TU119846 1.0 ml Ask for price

STK25 3'UTR GFP Stable Cell Line

TU074820 1.0 ml
EUR 1521

STK25 3'UTR Luciferase Stable Cell Line

TU024820 1.0 ml
EUR 1521

Stk25 3'UTR Luciferase Stable Cell Line

TU221313 1.0 ml Ask for price

Stk25 3'UTR GFP Stable Cell Line

TU271313 1.0 ml Ask for price

Human Serine/Threonine Kinase 25 (STK25) ELISA Kit

abx383521-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

STK25 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV639979 1.0 ug DNA
EUR 682

STK25 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV639983 1.0 ug DNA
EUR 682

STK25 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV639984 1.0 ug DNA
EUR 682

STK25 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV715515 1.0 ug DNA
EUR 316

STK25 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV715519 1.0 ug DNA
EUR 316

STK25 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV715520 1.0 ug DNA
EUR 316

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

STK25 Rabbit Polyclonal Antibody