Biocat Net

Amine biocat 3.0

STX6 Rabbit Polyclonal Antibody

STX6 Polyclonal Antibody

ABP60550-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human STX6 protein
  • Applications tips:
Description: A polyclonal antibody for detection of STX6 from Human, Mouse, Rat. This STX6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STX6 protein

STX6 Polyclonal Antibody

ABP60550-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human STX6 protein
  • Applications tips:
Description: A polyclonal antibody for detection of STX6 from Human, Mouse, Rat. This STX6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STX6 protein

STX6 Polyclonal Antibody

A57693 100 µg
EUR 570.55
Description: fast delivery possible

STX6 Polyclonal Antibody

A57697 100 µg
EUR 570.55
Description: Ask the seller for details

STX6 Rabbit pAb

A6343-100ul 100 ul
EUR 308

STX6 Rabbit pAb

A6343-200ul 200 ul
EUR 459

STX6 Rabbit pAb

A6343-20ul 20 ul Ask for price

STX6 Rabbit pAb

A6343-50ul 50 ul Ask for price

STX6 Rabbit pAb

A16283-100ul 100 ul
EUR 308

STX6 Rabbit pAb

A16283-200ul 200 ul
EUR 459

STX6 Rabbit pAb

A16283-20ul 20 ul
EUR 183

STX6 Rabbit pAb

A16283-50ul 50 ul
EUR 223

Polyclonal STX6 Antibody (Center)

AMM08044G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STX6 (Center). This antibody is tested and proven to work in the following applications:

STX6 Antibody

ABD9956 100 ug
EUR 438

STX6 antibody

70R-20626 50 ul
EUR 435
Description: Rabbit polyclonal STX6 antibody

STX6 Antibody

46271-100ul 100ul
EUR 252

STX6 Antibody

46271-50ul 50ul
EUR 187

STX6 Antibody

DF9956 200ul
EUR 304
Description: STX6 Antibody detects endogenous levels of total STX6.

STX6 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STX6. Recognizes STX6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

STX6 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against STX6. Recognizes STX6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

STX6 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STX6. Recognizes STX6 from Chicken, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

Polyclonal Goat Anti-STX6 Antibody

APR16404G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-STX6 . This antibody is tested and proven to work in the following applications:

STX6 Polyclonal Antibody, Biotin Conjugated

A57690 100 µg
EUR 570.55
Description: kits suitable for this type of research

STX6 Polyclonal Antibody, FITC Conjugated

A57691 100 µg
EUR 570.55
Description: fast delivery possible

STX6 Polyclonal Antibody, HRP Conjugated

A57692 100 µg
EUR 570.55
Description: reagents widely cited

STX6 Polyclonal Antibody, Biotin Conjugated

A57694 100 µg
EUR 570.55
Description: reagents widely cited

STX6 Polyclonal Antibody, FITC Conjugated

A57695 100 µg
EUR 570.55
Description: Ask the seller for details

STX6 Polyclonal Antibody, HRP Conjugated

A57696 100 µg
EUR 570.55
Description: The best epigenetics products

STX6 Conjugated Antibody

C46271 100ul
EUR 397

Anti-STX6 antibody

STJ70907 100 µg
EUR 359

Anti-STX6 antibody

STJ28265 100 µl
EUR 277

Anti-STX6 antibody

STJ118730 100 µl
EUR 277

Anti-STX6 antibody

STJ140096 150 µg
EUR 219
Description: Goat polyclonal to Syntaxin- 6 – trans-Golgi and endosome marker. This trans- Golgi and endosome protein regulates membrane trafficking by partnering with a variety of other SNARE proteins. This protein is also involved in the regulation of neutrophil exocytosis, granule secretion and GLUT4 trafficking.

Anti-STX6 antibody

STJ191500 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to STX6

Stx6/ Rat Stx6 ELISA Kit

ELI-41747r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Rabbit Syntaxin 6(STX6) ELISA kit

E04S0419-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Syntaxin 6(STX6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Syntaxin 6(STX6) ELISA kit

E04S0419-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Syntaxin 6(STX6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Syntaxin 6(STX6) ELISA kit

E04S0419-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Syntaxin 6(STX6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Syntaxin-6 (STX6) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Syntaxin-6 (STX6) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Syntaxin-6 (STX6) Antibody

abx028551-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Syntaxin-6 (STX6) Antibody

abx028551-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Syntaxin-6 (STX6) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Syntaxin-6 (STX6) Antibody

abx432036-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

STX6 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STX6. Recognizes STX6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

STX6 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STX6. Recognizes STX6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

STX6 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STX6. Recognizes STX6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

STX6 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STX6. Recognizes STX6 from Chicken. This antibody is HRP conjugated. Tested in the following application: ELISA

STX6 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STX6. Recognizes STX6 from Chicken. This antibody is FITC conjugated. Tested in the following application: ELISA

STX6 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STX6. Recognizes STX6 from Chicken. This antibody is Biotin conjugated. Tested in the following application: ELISA

STX6 cloning plasmid

CSB-CL022902HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 768
  • Sequence: atgtccatggaggaccccttctttgtggtgaaaggagaggtacagaaagcagtcaacactgcccagggattgtttcagagatggacagagctcctccaggacccctccacagcaacaagggaagaaatcgactggaccaccaacgagctgagaaataacctccggagcatagagtg
  • Show more
Description: A cloning plasmid for the STX6 gene.

STX6 Blocking Peptide

DF9956-BP 1mg
EUR 195

Syntaxin-6 (STX6) Antibody Pair

abx117631-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

Mouse STX6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat STX6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Syntaxin 6 (STX6) Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Human STX6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

STX6 protein (His tag)

80R-3049 100 ug
EUR 327
Description: Purified recombinant STX6 protein (His tag)

Chicken Syntaxin-6 (STX6)

  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 30.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Chicken Syntaxin-6(STX6),partial expressed in E.coli

Human Syntaxin-6 (STX6)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 53.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Syntaxin-6(STX6),partial expressed in E.coli

STX6 Recombinant Protein (Human)

RP030541 100 ug Ask for price

STX6 Recombinant Protein (Rat)

RP231608 100 ug Ask for price

STX6 Recombinant Protein (Mouse)

RP176279 100 ug Ask for price

Monoclonal STX6 Antibody (monoclonal) (M01), Clone: 1G2

AMM08045G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human STX6 (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 1G2. This antibody is applicable in WB, IHC and IF, E

Stx6 ORF Vector (Mouse) (pORF)

ORF058761 1.0 ug DNA
EUR 506

STX6 ORF Vector (Human) (pORF)

ORF010181 1.0 ug DNA
EUR 95

Stx6 ORF Vector (Rat) (pORF)

ORF077204 1.0 ug DNA
EUR 506

Mouse Syntaxin 6(STX6) ELISA kit

E03S0419-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Syntaxin 6(STX6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Syntaxin 6(STX6) ELISA kit

E03S0419-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Syntaxin 6(STX6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Syntaxin 6(STX6) ELISA kit

E03S0419-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Syntaxin 6(STX6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Syntaxin 6(STX6) ELISA kit

E02S0419-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Syntaxin 6(STX6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Syntaxin 6(STX6) ELISA kit

E02S0419-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Syntaxin 6(STX6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Syntaxin 6(STX6) ELISA kit

E02S0419-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Syntaxin 6(STX6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Syntaxin 6(STX6) ELISA kit

E01S0419-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Syntaxin 6(STX6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Syntaxin 6(STX6) ELISA kit

E01S0419-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Syntaxin 6(STX6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Syntaxin 6(STX6) ELISA kit

E01S0419-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Syntaxin 6(STX6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Syntaxin 6(STX6) ELISA kit

E06S0419-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Syntaxin 6(STX6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Syntaxin 6(STX6) ELISA kit

E06S0419-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Syntaxin 6(STX6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Syntaxin 6(STX6) ELISA kit

E06S0419-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Syntaxin 6(STX6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Syntaxin 6(STX6) ELISA kit

E08S0419-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Syntaxin 6(STX6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Syntaxin 6(STX6) ELISA kit

E08S0419-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Syntaxin 6(STX6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Syntaxin 6(STX6) ELISA kit

E08S0419-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Syntaxin 6(STX6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Syntaxin 6(STX6) ELISA kit

E07S0419-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Syntaxin 6(STX6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Syntaxin 6(STX6) ELISA kit

E07S0419-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Syntaxin 6(STX6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Syntaxin 6(STX6) ELISA kit

E07S0419-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Syntaxin 6(STX6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Syntaxin 6(STX6) ELISA kit

E09S0419-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Syntaxin 6(STX6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Syntaxin 6(STX6) ELISA kit

E09S0419-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Syntaxin 6(STX6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Syntaxin 6(STX6) ELISA kit

E09S0419-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Syntaxin 6(STX6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Syntaxin- 6, STX6 ELISA KIT

ELI-29276h 96 Tests
EUR 824

Chicken Syntaxin- 6, STX6 ELISA KIT

ELI-29906c 96 Tests
EUR 928

Mouse Syntaxin- 6, Stx6 ELISA KIT

ELI-29929m 96 Tests
EUR 865

Human Syntaxin 6 (STX6)ELISA Kit

201-12-2589 96 tests
EUR 440
  • This Syntaxin 6 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

STX6 sgRNA CRISPR Lentivector set (Human)

K2308701 3 x 1.0 ug
EUR 339

Stx6 sgRNA CRISPR Lentivector set (Mouse)

K3536501 3 x 1.0 ug
EUR 339

Stx6 sgRNA CRISPR Lentivector set (Rat)

K6877301 3 x 1.0 ug
EUR 339

STX6 Syntaxin-6 Human Recombinant Protein

PROTO43752 Regular: 20ug
EUR 317
Description: STX6 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 257 amino acids (1-234) and having a molecular mass of 29.2kDa.;STX6 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human Syntaxin 6(STX6)ELISA Kit

QY-E01166 96T
EUR 361

Guinea pig Syntaxin 6(STX6) ELISA kit

E05S0419-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Syntaxin 6(STX6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Syntaxin 6(STX6) ELISA kit

E05S0419-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Syntaxin 6(STX6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Syntaxin 6(STX6) ELISA kit

E05S0419-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Syntaxin 6(STX6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

STX6 sgRNA CRISPR Lentivector (Human) (Target 1)

K2308702 1.0 ug DNA
EUR 154

STX6 sgRNA CRISPR Lentivector (Human) (Target 2)

K2308703 1.0 ug DNA
EUR 154

STX6 sgRNA CRISPR Lentivector (Human) (Target 3)

K2308704 1.0 ug DNA
EUR 154

Stx6 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3536502 1.0 ug DNA
EUR 154

Stx6 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3536503 1.0 ug DNA
EUR 154

Stx6 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3536504 1.0 ug DNA
EUR 154

Stx6 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6877302 1.0 ug DNA
EUR 154

Stx6 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6877303 1.0 ug DNA
EUR 154

Stx6 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6877304 1.0 ug DNA
EUR 154

STX6 Protein Vector (Human) (pPB-C-His)

PV040721 500 ng
EUR 329

STX6 Protein Vector (Human) (pPB-N-His)

PV040722 500 ng
EUR 329

STX6 Protein Vector (Human) (pPM-C-HA)

PV040723 500 ng
EUR 329

STX6 Rabbit Polyclonal Antibody