SYN3 Rabbit Polyclonal Antibody

SYN3 Polyclonal Antibody

ABP60569-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SYN3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SYN3 from Human, Mouse, Rat. This SYN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SYN3 protein

Polyclonal SYN3 Antibody (Center)

APR13606G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SYN3 (Center). This antibody is tested and proven to work in the following applications:

SYN3 antibody

70R-10563 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SYN3 antibody

Syn3/ Rat Syn3 ELISA Kit

ELI-46233r 96 Tests
EUR 886

Anti-SYN3 antibody

STJ191485 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SYN3


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SYN3 cloning plasmid

CSB-CL023004HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1740
  • Sequence: atgaatttcctccggcgacgtctctctgacagcagcttcatggccaacctgcctaatggctatatgacggacctgcaacgcccagatagctccaccagctcacctgcttcccccgccatggagaggaggcacccccagcccctggctgcctccttctcctctccaggatccagcc
  • Show more
Description: A cloning plasmid for the SYN3 gene.

SYN3 Blocking Peptide

33R-3176 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SYN3 antibody, catalog no. 70R-10563

Mouse SYN3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat SYN3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SYN3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SYN3 Recombinant Protein (Human)

RP043873 100 ug Ask for price

SYN3 Recombinant Protein (Rat)

RP231887 100 ug Ask for price

SYN3 Recombinant Protein (Mouse)

RP176726 100 ug Ask for price

SYN3 Recombinant Protein (Mouse)

RP176729 100 ug Ask for price

Syn3 ORF Vector (Mouse) (pORF)

ORF058910 1.0 ug DNA
EUR 506

Syn3 ORF Vector (Mouse) (pORF)

ORF058911 1.0 ug DNA
EUR 506

Syn3 ORF Vector (Rat) (pORF)

ORF077297 1.0 ug DNA
EUR 506

SYN3 ORF Vector (Human) (pORF)

ORF014625 1.0 ug DNA
EUR 354

SYN3 ELISA Kit (Mouse) (OKCA01780)

OKCA01780 96 Wells
EUR 846
Description: Description of target: May be involved in the regulation of neurotransmitter release and synaptogenesis. Binds ATP with high affinity and ADP with a lower affinity. This is consistent with a catalytic role of the C-domain in which ADP would be dissociated by cellular ATP after bound ATP was hydrolyzed.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7.81 pg/mL

Human Synapsin- 3, SYN3 ELISA KIT

ELI-46232h 96 Tests
EUR 824

Mouse Synapsin- 3, Syn3 ELISA KIT

ELI-29326m 96 Tests
EUR 865

SYN3 sgRNA CRISPR Lentivector set (Human)

K2320101 3 x 1.0 ug
EUR 339

Syn3 sgRNA CRISPR Lentivector set (Mouse)

K4659401 3 x 1.0 ug
EUR 339

Syn3 sgRNA CRISPR Lentivector set (Rat)

K6899801 3 x 1.0 ug
EUR 339

Human Synapsin III(SYN3)ELISA Kit

QY-E01203 96T
EUR 413

SYN3 sgRNA CRISPR Lentivector (Human) (Target 1)

K2320102 1.0 ug DNA
EUR 154

SYN3 sgRNA CRISPR Lentivector (Human) (Target 2)

K2320103 1.0 ug DNA
EUR 154

SYN3 sgRNA CRISPR Lentivector (Human) (Target 3)

K2320104 1.0 ug DNA
EUR 154

Syn3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4659402 1.0 ug DNA
EUR 154

Syn3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4659403 1.0 ug DNA
EUR 154

Syn3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4659404 1.0 ug DNA
EUR 154

Syn3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6899802 1.0 ug DNA
EUR 154

Syn3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6899803 1.0 ug DNA
EUR 154

Syn3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6899804 1.0 ug DNA
EUR 154

SYN3 Protein Vector (Human) (pPB-C-His)

PV058497 500 ng
EUR 481

SYN3 Protein Vector (Human) (pPB-N-His)

PV058498 500 ng
EUR 481

SYN3 Protein Vector (Human) (pPM-C-HA)

PV058499 500 ng
EUR 481

SYN3 Protein Vector (Human) (pPM-C-His)

PV058500 500 ng
EUR 481

SYN3 Protein Vector (Rat) (pPB-C-His)

PV309186 500 ng
EUR 603

SYN3 Protein Vector (Rat) (pPB-N-His)

PV309187 500 ng
EUR 603

SYN3 Protein Vector (Rat) (pPM-C-HA)

PV309188 500 ng
EUR 603

SYN3 Protein Vector (Rat) (pPM-C-His)

PV309189 500 ng
EUR 603

SYN3 Protein Vector (Mouse) (pPB-C-His)

PV235638 500 ng
EUR 603

SYN3 Protein Vector (Mouse) (pPB-N-His)

PV235639 500 ng
EUR 603

SYN3 Protein Vector (Mouse) (pPM-C-HA)

PV235640 500 ng
EUR 603

SYN3 Protein Vector (Mouse) (pPM-C-His)

PV235641 500 ng
EUR 603

SYN3 Protein Vector (Mouse) (pPB-C-His)

PV235642 500 ng
EUR 603

SYN3 Protein Vector (Mouse) (pPB-N-His)

PV235643 500 ng
EUR 603

SYN3 Protein Vector (Mouse) (pPM-C-HA)

PV235644 500 ng
EUR 603

SYN3 Protein Vector (Mouse) (pPM-C-His)

PV235645 500 ng
EUR 603

Syn3 3'UTR GFP Stable Cell Line

TU170012 1.0 ml Ask for price

Syn3 3'UTR Luciferase Stable Cell Line

TU120012 1.0 ml Ask for price

SYN3 3'UTR GFP Stable Cell Line

TU074996 1.0 ml
EUR 1394

SYN3 3'UTR Luciferase Stable Cell Line

TU024996 1.0 ml
EUR 1394

Syn3 3'UTR Luciferase Stable Cell Line

TU221459 1.0 ml Ask for price

Syn3 3'UTR GFP Stable Cell Line

TU271459 1.0 ml Ask for price

SYN3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV694705 1.0 ug DNA
EUR 682

SYN3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV694709 1.0 ug DNA
EUR 682

SYN3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV694710 1.0 ug DNA
EUR 682

SYN3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV702537 1.0 ug DNA
EUR 450

SYN3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV702541 1.0 ug DNA
EUR 450

SYN3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV702542 1.0 ug DNA
EUR 450

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

SYN3 Rabbit Polyclonal Antibody