 SYN3 Polyclonal Antibody |
|
ABP60569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human SYN3 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of SYN3 from Human, Mouse, Rat. This SYN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SYN3 protein |
) Polyclonal SYN3 Antibody (Center) |
|
APR13606G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SYN3 (Center). This antibody is tested and proven to work in the following applications: |
 SYN3 antibody |
|
70R-10563 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Affinity purified rabbit polyclonal SYN3 antibody |
 Anti-SYN3 antibody |
|
STJ191485 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to SYN3 |
 SYN3 siRNA |
|
20-abx905398 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SYN3 siRNA |
|
20-abx935784 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SYN3 siRNA |
|
20-abx935785 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 SYN3 cloning plasmid |
|
CSB-CL023004HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1740
- Sequence: atgaatttcctccggcgacgtctctctgacagcagcttcatggccaacctgcctaatggctatatgacggacctgcaacgcccagatagctccaccagctcacctgcttcccccgccatggagaggaggcacccccagcccctggctgcctccttctcctctccaggatccagcc
- Show more
|
|
Description: A cloning plasmid for the SYN3 gene. |
 SYN3 Blocking Peptide |
|
33R-3176 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SYN3 antibody, catalog no. 70R-10563 |
 Mouse SYN3 shRNA Plasmid |
|
20-abx973837 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Rat SYN3 shRNA Plasmid |
|
20-abx985301 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human SYN3 shRNA Plasmid |
|
20-abx955403 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) SYN3 Recombinant Protein (Human) |
|
RP043873 |
ABM |
100 ug |
Ask for price |
) SYN3 Recombinant Protein (Rat) |
|
RP231887 |
ABM |
100 ug |
Ask for price |
) SYN3 Recombinant Protein (Mouse) |
|
RP176726 |
ABM |
100 ug |
Ask for price |
SYN3 Recombinant Protein (Mouse) |
|
RP176729 |
ABM |
100 ug |
Ask for price |
 (pORF)) Syn3 ORF Vector (Mouse) (pORF) |
|
ORF058910 |
ABM |
1.0 ug DNA |
EUR 506 |
Syn3 ORF Vector (Mouse) (pORF) |
|
ORF058911 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Syn3 ORF Vector (Rat) (pORF) |
|
ORF077297 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) SYN3 ORF Vector (Human) (pORF) |
|
ORF014625 |
ABM |
1.0 ug DNA |
EUR 354 |
 (OKCA01780)) SYN3 ELISA Kit (Mouse) (OKCA01780) |
|
OKCA01780 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
|
Description: Description of target: May be involved in the regulation of neurotransmitter release and synaptogenesis. Binds ATP with high affinity and ADP with a lower affinity. This is consistent with a catalytic role of the C-domain in which ADP would be dissociated by cellular ATP after bound ATP was hydrolyzed.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7.81 pg/mL |
) SYN3 sgRNA CRISPR Lentivector set (Human) |
|
K2320101 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Syn3 sgRNA CRISPR Lentivector set (Mouse) |
|
K4659401 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Syn3 sgRNA CRISPR Lentivector set (Rat) |
|
K6899801 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) SYN3 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2320102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) SYN3 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2320103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) SYN3 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2320104 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Syn3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4659402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Syn3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4659403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Syn3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4659404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Syn3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6899802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Syn3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6899803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Syn3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6899804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) SYN3 Protein Vector (Human) (pPB-C-His) |
|
PV058497 |
ABM |
500 ng |
EUR 481 |
 (pPB-N-His)) SYN3 Protein Vector (Human) (pPB-N-His) |
|
PV058498 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-HA)) SYN3 Protein Vector (Human) (pPM-C-HA) |
|
PV058499 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-His)) SYN3 Protein Vector (Human) (pPM-C-His) |
|
PV058500 |
ABM |
500 ng |
EUR 481 |
 (pPB-C-His)) SYN3 Protein Vector (Rat) (pPB-C-His) |
|
PV309186 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) SYN3 Protein Vector (Rat) (pPB-N-His) |
|
PV309187 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) SYN3 Protein Vector (Rat) (pPM-C-HA) |
|
PV309188 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) SYN3 Protein Vector (Rat) (pPM-C-His) |
|
PV309189 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) SYN3 Protein Vector (Mouse) (pPB-C-His) |
|
PV235638 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) SYN3 Protein Vector (Mouse) (pPB-N-His) |
|
PV235639 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) SYN3 Protein Vector (Mouse) (pPM-C-HA) |
|
PV235640 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) SYN3 Protein Vector (Mouse) (pPM-C-His) |
|
PV235641 |
ABM |
500 ng |
EUR 603 |
SYN3 Protein Vector (Mouse) (pPB-C-His) |
|
PV235642 |
ABM |
500 ng |
EUR 603 |
SYN3 Protein Vector (Mouse) (pPB-N-His) |
|
PV235643 |
ABM |
500 ng |
EUR 603 |
SYN3 Protein Vector (Mouse) (pPM-C-HA) |
|
PV235644 |
ABM |
500 ng |
EUR 603 |
SYN3 Protein Vector (Mouse) (pPM-C-His) |
|
PV235645 |
ABM |
500 ng |
EUR 603 |
 Syn3 3'UTR GFP Stable Cell Line |
|
TU170012 |
ABM |
1.0 ml |
Ask for price |
 Syn3 3'UTR Luciferase Stable Cell Line |
|
TU120012 |
ABM |
1.0 ml |
Ask for price |
 SYN3 3'UTR GFP Stable Cell Line |
|
TU074996 |
ABM |
1.0 ml |
EUR 1394 |
 SYN3 3'UTR Luciferase Stable Cell Line |
|
TU024996 |
ABM |
1.0 ml |
EUR 1394 |
Syn3 3'UTR Luciferase Stable Cell Line |
|
TU221459 |
ABM |
1.0 ml |
Ask for price |
Syn3 3'UTR GFP Stable Cell Line |
|
TU271459 |
ABM |
1.0 ml |
Ask for price |
 (CMV) (pLenti-GIII-CMV)) SYN3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV694705 |
ABM |
1.0 ug DNA |
EUR 682 |
 (UbC) (pLenti-GIII-UbC)) SYN3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV694709 |
ABM |
1.0 ug DNA |
EUR 682 |
 (EF1a) (pLenti-GIII-EF1a)) SYN3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV694710 |
ABM |
1.0 ug DNA |
EUR 682 |
 (CMV) (pLenti-GIII-CMV)) SYN3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
|
LV702537 |
ABM |
1.0 ug DNA |
EUR 450 |
 (UbC) (pLenti-GIII-UbC)) SYN3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
|
LV702541 |
ABM |
1.0 ug DNA |
EUR 450 |
 (EF1a) (pLenti-GIII-EF1a)) SYN3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
|
LV702542 |
ABM |
1.0 ug DNA |
EUR 450 |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
SYN3 Rabbit Polyclonal Antibody
ELISA Kit)