SYN3 Rabbit Polyclonal Antibody

SYN3 Polyclonal Antibody

ES10327-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SYN3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Polyclonal SYN3 Antibody (Center)

APR13606G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SYN3 (Center). This antibody is tested and proven to work in the following applications:

SYN3 antibody

70R-10563 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SYN3 antibody

Syn3/ Rat Syn3 ELISA Kit

ELI-46233r 96 Tests
EUR 886

Anti-SYN3 antibody

STJ191485 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SYN3

SYN3 siRNA

20-abx905398
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SYN3 siRNA

20-abx935784
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SYN3 siRNA

20-abx935785
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SYN3 Blocking Peptide

33R-3176 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SYN3 antibody, catalog no. 70R-10563

SYN3 cloning plasmid

CSB-CL023004HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1740
  • Sequence: atgaatttcctccggcgacgtctctctgacagcagcttcatggccaacctgcctaatggctatatgacggacctgcaacgcccagatagctccaccagctcacctgcttcccccgccatggagaggaggcacccccagcccctggctgcctccttctcctctccaggatccagcc
  • Show more
Description: A cloning plasmid for the SYN3 gene.

Mouse SYN3 shRNA Plasmid

20-abx973837
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat SYN3 shRNA Plasmid

20-abx985301
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SYN3 shRNA Plasmid

20-abx955403
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SYN3 Recombinant Protein (Rat)

RP231887 100 ug Ask for price

SYN3 Recombinant Protein (Human)

RP043873 100 ug Ask for price

SYN3 Recombinant Protein (Mouse)

RP176726 100 ug Ask for price

SYN3 Recombinant Protein (Mouse)

RP176729 100 ug Ask for price

Syn3 ORF Vector (Rat) (pORF)

ORF077297 1.0 ug DNA
EUR 506

SYN3 ORF Vector (Human) (pORF)

ORF014625 1.0 ug DNA
EUR 354

Syn3 ORF Vector (Mouse) (pORF)

ORF058910 1.0 ug DNA
EUR 506

Syn3 ORF Vector (Mouse) (pORF)

ORF058911 1.0 ug DNA
EUR 506

Mouse Synapsin- 3, Syn3 ELISA KIT

ELI-29326m 96 Tests
EUR 865

Human Synapsin- 3, SYN3 ELISA KIT

ELI-46232h 96 Tests
EUR 824

Syn3 sgRNA CRISPR Lentivector set (Rat)

K6899801 3 x 1.0 ug
EUR 339

Syn3 sgRNA CRISPR Lentivector set (Mouse)

K4659401 3 x 1.0 ug
EUR 339

SYN3 sgRNA CRISPR Lentivector set (Human)

K2320101 3 x 1.0 ug
EUR 339

Human Synapsin III(SYN3)ELISA Kit

QY-E01203 96T
EUR 413

Syn3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6899802 1.0 ug DNA
EUR 154

Syn3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6899803 1.0 ug DNA
EUR 154

Syn3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6899804 1.0 ug DNA
EUR 154

Syn3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4659402 1.0 ug DNA
EUR 154

Syn3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4659403 1.0 ug DNA
EUR 154

Syn3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4659404 1.0 ug DNA
EUR 154

SYN3 sgRNA CRISPR Lentivector (Human) (Target 1)

K2320102 1.0 ug DNA
EUR 154

SYN3 sgRNA CRISPR Lentivector (Human) (Target 2)

K2320103 1.0 ug DNA
EUR 154

SYN3 sgRNA CRISPR Lentivector (Human) (Target 3)

K2320104 1.0 ug DNA
EUR 154

SYN3 Protein Vector (Rat) (pPB-C-His)

PV309186 500 ng
EUR 603

SYN3 Protein Vector (Rat) (pPB-N-His)

PV309187 500 ng
EUR 603

SYN3 Protein Vector (Rat) (pPM-C-HA)

PV309188 500 ng
EUR 603

SYN3 Protein Vector (Rat) (pPM-C-His)

PV309189 500 ng
EUR 603

SYN3 Protein Vector (Human) (pPB-C-His)

PV058497 500 ng
EUR 481

SYN3 Protein Vector (Human) (pPB-N-His)

PV058498 500 ng
EUR 481

SYN3 Protein Vector (Human) (pPM-C-HA)

PV058499 500 ng
EUR 481

SYN3 Protein Vector (Human) (pPM-C-His)

PV058500 500 ng
EUR 481

SYN3 Protein Vector (Mouse) (pPB-C-His)

PV235638 500 ng
EUR 603

SYN3 Protein Vector (Mouse) (pPB-N-His)

PV235639 500 ng
EUR 603

SYN3 Protein Vector (Mouse) (pPM-C-HA)

PV235640 500 ng
EUR 603

SYN3 Protein Vector (Mouse) (pPM-C-His)

PV235641 500 ng
EUR 603

SYN3 Protein Vector (Mouse) (pPB-C-His)

PV235642 500 ng
EUR 603

SYN3 Protein Vector (Mouse) (pPB-N-His)

PV235643 500 ng
EUR 603

SYN3 Protein Vector (Mouse) (pPM-C-HA)

PV235644 500 ng
EUR 603

SYN3 Protein Vector (Mouse) (pPM-C-His)

PV235645 500 ng
EUR 603

Syn3 3'UTR Luciferase Stable Cell Line

TU120012 1.0 ml Ask for price

Syn3 3'UTR GFP Stable Cell Line

TU170012 1.0 ml Ask for price

Syn3 3'UTR Luciferase Stable Cell Line

TU221459 1.0 ml Ask for price

SYN3 3'UTR GFP Stable Cell Line

TU074996 1.0 ml
EUR 1394

Syn3 3'UTR GFP Stable Cell Line

TU271459 1.0 ml Ask for price

SYN3 3'UTR Luciferase Stable Cell Line

TU024996 1.0 ml
EUR 1394

SYN3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV694705 1.0 ug DNA
EUR 682

SYN3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV694709 1.0 ug DNA
EUR 682

SYN3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV694710 1.0 ug DNA
EUR 682

SYN3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV702537 1.0 ug DNA
EUR 450

SYN3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV702541 1.0 ug DNA
EUR 450

SYN3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV702542 1.0 ug DNA
EUR 450

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

SYN3 Rabbit Polyclonal Antibody