 SYN3 Polyclonal Antibody |
|
ES10327-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against SYN3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
) Polyclonal SYN3 Antibody (Center) |
|
APR13606G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SYN3 (Center). This antibody is tested and proven to work in the following applications: |
 SYN3 antibody |
|
70R-10563 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Affinity purified rabbit polyclonal SYN3 antibody |
 Anti-SYN3 antibody |
|
STJ191485 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to SYN3 |
 SYN3 siRNA |
|
20-abx905398 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SYN3 siRNA |
|
20-abx935784 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SYN3 siRNA |
|
20-abx935785 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 SYN3 Blocking Peptide |
|
33R-3176 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SYN3 antibody, catalog no. 70R-10563 |
 SYN3 cloning plasmid |
|
CSB-CL023004HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1740
- Sequence: atgaatttcctccggcgacgtctctctgacagcagcttcatggccaacctgcctaatggctatatgacggacctgcaacgcccagatagctccaccagctcacctgcttcccccgccatggagaggaggcacccccagcccctggctgcctccttctcctctccaggatccagcc
- Show more
|
|
Description: A cloning plasmid for the SYN3 gene. |
 Mouse SYN3 shRNA Plasmid |
|
20-abx973837 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Rat SYN3 shRNA Plasmid |
|
20-abx985301 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human SYN3 shRNA Plasmid |
|
20-abx955403 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) SYN3 Recombinant Protein (Rat) |
|
RP231887 |
ABM |
100 ug |
Ask for price |
) SYN3 Recombinant Protein (Human) |
|
RP043873 |
ABM |
100 ug |
Ask for price |
) SYN3 Recombinant Protein (Mouse) |
|
RP176726 |
ABM |
100 ug |
Ask for price |
SYN3 Recombinant Protein (Mouse) |
|
RP176729 |
ABM |
100 ug |
Ask for price |
 (pORF)) Syn3 ORF Vector (Rat) (pORF) |
|
ORF077297 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) SYN3 ORF Vector (Human) (pORF) |
|
ORF014625 |
ABM |
1.0 ug DNA |
EUR 354 |
 (pORF)) Syn3 ORF Vector (Mouse) (pORF) |
|
ORF058910 |
ABM |
1.0 ug DNA |
EUR 506 |
Syn3 ORF Vector (Mouse) (pORF) |
|
ORF058911 |
ABM |
1.0 ug DNA |
EUR 506 |
) Syn3 sgRNA CRISPR Lentivector set (Rat) |
|
K6899801 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Syn3 sgRNA CRISPR Lentivector set (Mouse) |
|
K4659401 |
ABM |
3 x 1.0 ug |
EUR 339 |
) SYN3 sgRNA CRISPR Lentivector set (Human) |
|
K2320101 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) Syn3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6899802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Syn3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6899803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Syn3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6899804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Syn3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4659402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Syn3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4659403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Syn3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4659404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) SYN3 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2320102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) SYN3 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2320103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) SYN3 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2320104 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) SYN3 Protein Vector (Rat) (pPB-C-His) |
|
PV309186 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) SYN3 Protein Vector (Rat) (pPB-N-His) |
|
PV309187 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) SYN3 Protein Vector (Rat) (pPM-C-HA) |
|
PV309188 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) SYN3 Protein Vector (Rat) (pPM-C-His) |
|
PV309189 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) SYN3 Protein Vector (Human) (pPB-C-His) |
|
PV058497 |
ABM |
500 ng |
EUR 481 |
 (pPB-N-His)) SYN3 Protein Vector (Human) (pPB-N-His) |
|
PV058498 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-HA)) SYN3 Protein Vector (Human) (pPM-C-HA) |
|
PV058499 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-His)) SYN3 Protein Vector (Human) (pPM-C-His) |
|
PV058500 |
ABM |
500 ng |
EUR 481 |
 (pPB-C-His)) SYN3 Protein Vector (Mouse) (pPB-C-His) |
|
PV235638 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) SYN3 Protein Vector (Mouse) (pPB-N-His) |
|
PV235639 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) SYN3 Protein Vector (Mouse) (pPM-C-HA) |
|
PV235640 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) SYN3 Protein Vector (Mouse) (pPM-C-His) |
|
PV235641 |
ABM |
500 ng |
EUR 603 |
SYN3 Protein Vector (Mouse) (pPB-C-His) |
|
PV235642 |
ABM |
500 ng |
EUR 603 |
SYN3 Protein Vector (Mouse) (pPB-N-His) |
|
PV235643 |
ABM |
500 ng |
EUR 603 |
SYN3 Protein Vector (Mouse) (pPM-C-HA) |
|
PV235644 |
ABM |
500 ng |
EUR 603 |
SYN3 Protein Vector (Mouse) (pPM-C-His) |
|
PV235645 |
ABM |
500 ng |
EUR 603 |
 Syn3 3'UTR Luciferase Stable Cell Line |
|
TU120012 |
ABM |
1.0 ml |
Ask for price |
 Syn3 3'UTR GFP Stable Cell Line |
|
TU170012 |
ABM |
1.0 ml |
Ask for price |
Syn3 3'UTR Luciferase Stable Cell Line |
|
TU221459 |
ABM |
1.0 ml |
Ask for price |
 SYN3 3'UTR GFP Stable Cell Line |
|
TU074996 |
ABM |
1.0 ml |
EUR 1394 |
Syn3 3'UTR GFP Stable Cell Line |
|
TU271459 |
ABM |
1.0 ml |
Ask for price |
 SYN3 3'UTR Luciferase Stable Cell Line |
|
TU024996 |
ABM |
1.0 ml |
EUR 1394 |
 (CMV) (pLenti-GIII-CMV)) SYN3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV694705 |
ABM |
1.0 ug DNA |
EUR 682 |
 (UbC) (pLenti-GIII-UbC)) SYN3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV694709 |
ABM |
1.0 ug DNA |
EUR 682 |
 (EF1a) (pLenti-GIII-EF1a)) SYN3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV694710 |
ABM |
1.0 ug DNA |
EUR 682 |
 (CMV) (pLenti-GIII-CMV)) SYN3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
|
LV702537 |
ABM |
1.0 ug DNA |
EUR 450 |
 (UbC) (pLenti-GIII-UbC)) SYN3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
|
LV702541 |
ABM |
1.0 ug DNA |
EUR 450 |
 (EF1a) (pLenti-GIII-EF1a)) SYN3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
|
LV702542 |
ABM |
1.0 ug DNA |
EUR 450 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
 NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
SYN3 Rabbit Polyclonal Antibody
ELISA Kit)