SYT12 Rabbit Polyclonal Antibody

SYT12 Polyclonal Antibody

ES10331-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SYT12 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

SYT12 antibody

70R-20675 50 ul
EUR 435
Description: Rabbit polyclonal SYT12 antibody

SYT12 antibody

70R-9795 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SYT12 antibody

SYT12 Antibody

1-CSB-PA023032GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SYT12. Recognizes SYT12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal SYT12 antibody - N-terminal region

APR13657G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SYT12 - N-terminal region. This antibody is tested and proven to work in the following applications:

Syt12/ Rat Syt12 ELISA Kit

ELI-18748r 96 Tests
EUR 886

Anti-SYT12 antibody

STJ191489 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SYT12

SYT12 siRNA

20-abx905411
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SYT12 siRNA

20-abx935841
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SYT12 siRNA

20-abx935842
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Synaptotagmin Xii (SYT12) Antibody

20-abx115954
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Synaptotagmin 12 (SYT12) Antibody

abx145664-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Synaptotagmin-12 (Syt12) Antibody

abx238427-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody

abx445048-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.

SYT12 Blocking Peptide

33R-1114 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NOL3 antibody, catalog no. 70R-10531

SYT12 cloning plasmid

CSB-CL818232HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1266
  • Sequence: atggctgtggatgtggcagaataccatctgagcgtcatcaagagcccccctggctgggaggtgggtgtctatgctgcaggggccctggccctgctgggaatcgcagctgtgagcctgtggaagctctggacgtcggggagcttccccagcccctctccgttccccaattacgact
  • Show more
Description: A cloning plasmid for the SYT12 gene.

Synaptotagmin-12 (Syt12) Antibody (ALP)

abx442445-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody (APC)

abx442726-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody (Biotin)

abx443006-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody (FITC)

abx443286-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody (HRP)

abx443567-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody (PerCP)

abx444129-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody (RPE)

abx444410-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody (Streptavidin)

abx444691-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Rat SYT12 shRNA Plasmid

20-abx987820
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SYT12 shRNA Plasmid

20-abx964065
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse SYT12 shRNA Plasmid

20-abx980375
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SYT12 Recombinant Protein (Rat)

RP231971 100 ug Ask for price

SYT12 Recombinant Protein (Human)

RP030772 100 ug Ask for price

SYT12 Recombinant Protein (Mouse)

RP176858 100 ug Ask for price

Synaptotagmin-12 (Syt12) Antibody (ATTO 390)

abx440197-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody (ATTO 488)

abx440478-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody (ATTO 565)

abx440759-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody (ATTO 594)

abx441040-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody (ATTO 633)

abx441321-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody (ATTO 655)

abx441602-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody (ATTO 680)

abx441883-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody (ATTO 700)

abx442164-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-12 (Syt12) Antibody (PE/ATTO 594)

abx443848-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Syt12 ORF Vector (Rat) (pORF)

ORF077325 1.0 ug DNA
EUR 506

SYT12 ORF Vector (Human) (pORF)

ORF010258 1.0 ug DNA
EUR 95

Syt12 ORF Vector (Mouse) (pORF)

ORF058954 1.0 ug DNA
EUR 506

Human Synaptotagmin XII (SYT12)ELISA Kit

201-12-2575 96 tests
EUR 440
  • This Synaptotagmin XII ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Synaptotagmin- 12, SYT12 ELISA KIT

ELI-19047h 96 Tests
EUR 824

Mouse Synaptotagmin- 12, Syt12 ELISA KIT

ELI-52194m 96 Tests
EUR 865

Human Synaptotagmin 12 (SYT12) ELISA Kit

abx383590-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Syt12 sgRNA CRISPR Lentivector set (Rat)

K6942201 3 x 1.0 ug
EUR 339

Syt12 sgRNA CRISPR Lentivector set (Mouse)

K3603401 3 x 1.0 ug
EUR 339

SYT12 sgRNA CRISPR Lentivector set (Human)

K2323601 3 x 1.0 ug
EUR 339

Human Synaptotagmin XII(SYT12)ELISA Kit

QY-E01180 96T
EUR 361

ELISA kit for Rat Synaptotagmin-12 (SYT12)

KTE100155-48T 48T
EUR 332
  • SYT12 is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. Studies of the orthologous gene in rat have shown tha
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-12 (SYT12) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Synaptotagmin-12 (SYT12)

KTE100155-5platesof96wells 5 plates of 96 wells
EUR 2115
  • SYT12 is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. Studies of the orthologous gene in rat have shown tha
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-12 (SYT12) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Synaptotagmin-12 (SYT12)

KTE100155-96T 96T
EUR 539
  • SYT12 is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. Studies of the orthologous gene in rat have shown tha
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-12 (SYT12) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Syt12 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6942202 1.0 ug DNA
EUR 154

Syt12 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6942203 1.0 ug DNA
EUR 154

Syt12 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6942204 1.0 ug DNA
EUR 154

Syt12 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3603402 1.0 ug DNA
EUR 154

Syt12 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3603403 1.0 ug DNA
EUR 154

Syt12 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3603404 1.0 ug DNA
EUR 154

SYT12 sgRNA CRISPR Lentivector (Human) (Target 1)

K2323602 1.0 ug DNA
EUR 154

SYT12 sgRNA CRISPR Lentivector (Human) (Target 2)

K2323603 1.0 ug DNA
EUR 154

SYT12 sgRNA CRISPR Lentivector (Human) (Target 3)

K2323604 1.0 ug DNA
EUR 154

ELISA kit for Human Synaptotagmin-12 (SYT12)

KTE60427-48T 48T
EUR 332
  • Syt12 colocalises with and binds Syt1 on synaptic vesicles, but regulates spontaneous release independently from Syt1. Syt12 is phosphorylated by cAMP-dependent protein kinase A (PKA) at a single site, and mutation of this site blocks the effect of S
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-12 (SYT12) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-12 (SYT12)

KTE60427-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Syt12 colocalises with and binds Syt1 on synaptic vesicles, but regulates spontaneous release independently from Syt1. Syt12 is phosphorylated by cAMP-dependent protein kinase A (PKA) at a single site, and mutation of this site blocks the effect of S
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-12 (SYT12) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-12 (SYT12)

KTE60427-96T 96T
EUR 539
  • Syt12 colocalises with and binds Syt1 on synaptic vesicles, but regulates spontaneous release independently from Syt1. Syt12 is phosphorylated by cAMP-dependent protein kinase A (PKA) at a single site, and mutation of this site blocks the effect of S
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-12 (SYT12) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-12 (SYT12)

KTE70297-48T 48T
EUR 332
  • SYT12 is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. Studies of the orthologous gene in rat have shown tha
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-12 (SYT12) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-12 (SYT12)

KTE70297-5platesof96wells 5 plates of 96 wells
EUR 2115
  • SYT12 is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. Studies of the orthologous gene in rat have shown tha
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-12 (SYT12) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-12 (SYT12)

KTE70297-96T 96T
EUR 539
  • SYT12 is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. Studies of the orthologous gene in rat have shown tha
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-12 (SYT12) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

SYT12 Protein Vector (Rat) (pPB-C-His)

PV309298 500 ng
EUR 603

SYT12 Protein Vector (Rat) (pPB-N-His)

PV309299 500 ng
EUR 603

SYT12 Protein Vector (Rat) (pPM-C-HA)

PV309300 500 ng
EUR 603

SYT12 Protein Vector (Rat) (pPM-C-His)

PV309301 500 ng
EUR 603

SYT12 Protein Vector (Human) (pPB-C-His)

PV041029 500 ng
EUR 329

SYT12 Protein Vector (Human) (pPB-N-His)

PV041030 500 ng
EUR 329

SYT12 Protein Vector (Human) (pPM-C-HA)

PV041031 500 ng
EUR 329

SYT12 Protein Vector (Human) (pPM-C-His)

PV041032 500 ng
EUR 329

SYT12 Protein Vector (Mouse) (pPB-C-His)

PV235814 500 ng
EUR 603

SYT12 Protein Vector (Mouse) (pPB-N-His)

PV235815 500 ng
EUR 603

SYT12 Protein Vector (Mouse) (pPM-C-HA)

PV235816 500 ng
EUR 603

SYT12 Protein Vector (Mouse) (pPM-C-His)

PV235817 500 ng
EUR 603

Syt12 3'UTR Luciferase Stable Cell Line

TU120038 1.0 ml Ask for price

Syt12 3'UTR GFP Stable Cell Line

TU170038 1.0 ml Ask for price

Syt12 3'UTR Luciferase Stable Cell Line

TU221484 1.0 ml Ask for price

SYT12 3'UTR GFP Stable Cell Line

TU075032 1.0 ml
EUR 1521

Syt12 3'UTR GFP Stable Cell Line

TU271484 1.0 ml Ask for price

SYT12 3'UTR Luciferase Stable Cell Line

TU025032 1.0 ml
EUR 1521

SYT12 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV658111 1.0 ug DNA
EUR 682

SYT12 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV658115 1.0 ug DNA
EUR 682

SYT12 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV658116 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

SYT12 Rabbit Polyclonal Antibody