SYT12 Polyclonal Antibody |
ES10331-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against SYT12 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
SYT12 antibody |
70R-20675 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal SYT12 antibody |
SYT12 antibody |
70R-9795 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal SYT12 antibody |
SYT12 Antibody |
1-CSB-PA023032GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against SYT12. Recognizes SYT12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Polyclonal SYT12 antibody - N-terminal region |
APR13657G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SYT12 - N-terminal region. This antibody is tested and proven to work in the following applications: |
Anti-SYT12 antibody |
STJ191489 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to SYT12 |
SYT12 siRNA |
20-abx905411 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SYT12 siRNA |
20-abx935841 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SYT12 siRNA |
20-abx935842 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Synaptotagmin Xii (SYT12) Antibody |
20-abx115954 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Synaptotagmin 12 (SYT12) Antibody |
abx145664-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Synaptotagmin-12 (Syt12) Antibody |
abx238427-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Synaptotagmin-12 (Syt12) Antibody |
abx445048-100ug |
Abbexa |
100 ug |
EUR 523 |
- Shipped within 5-12 working days.
|
SYT12 Blocking Peptide |
33R-1114 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NOL3 antibody, catalog no. 70R-10531 |
SYT12 cloning plasmid |
CSB-CL818232HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1266
- Sequence: atggctgtggatgtggcagaataccatctgagcgtcatcaagagcccccctggctgggaggtgggtgtctatgctgcaggggccctggccctgctgggaatcgcagctgtgagcctgtggaagctctggacgtcggggagcttccccagcccctctccgttccccaattacgact
- Show more
|
Description: A cloning plasmid for the SYT12 gene. |
Synaptotagmin-12 (Syt12) Antibody (ALP) |
abx442445-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Synaptotagmin-12 (Syt12) Antibody (APC) |
abx442726-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Synaptotagmin-12 (Syt12) Antibody (Biotin) |
abx443006-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Synaptotagmin-12 (Syt12) Antibody (FITC) |
abx443286-100ug |
Abbexa |
100 ug |
EUR 565 |
- Shipped within 5-12 working days.
|
Synaptotagmin-12 (Syt12) Antibody (HRP) |
abx443567-100ug |
Abbexa |
100 ug |
EUR 565 |
- Shipped within 5-12 working days.
|
Synaptotagmin-12 (Syt12) Antibody (PerCP) |
abx444129-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Synaptotagmin-12 (Syt12) Antibody (RPE) |
abx444410-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Synaptotagmin-12 (Syt12) Antibody (Streptavidin) |
abx444691-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Rat SYT12 shRNA Plasmid |
20-abx987820 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human SYT12 shRNA Plasmid |
20-abx964065 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse SYT12 shRNA Plasmid |
20-abx980375 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SYT12 Recombinant Protein (Rat) |
RP231971 |
ABM |
100 ug |
Ask for price |
SYT12 Recombinant Protein (Human) |
RP030772 |
ABM |
100 ug |
Ask for price |
SYT12 Recombinant Protein (Mouse) |
RP176858 |
ABM |
100 ug |
Ask for price |
Synaptotagmin-12 (Syt12) Antibody (ATTO 390) |
abx440197-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Synaptotagmin-12 (Syt12) Antibody (ATTO 488) |
abx440478-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Synaptotagmin-12 (Syt12) Antibody (ATTO 565) |
abx440759-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Synaptotagmin-12 (Syt12) Antibody (ATTO 594) |
abx441040-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Synaptotagmin-12 (Syt12) Antibody (ATTO 633) |
abx441321-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Synaptotagmin-12 (Syt12) Antibody (ATTO 655) |
abx441602-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Synaptotagmin-12 (Syt12) Antibody (ATTO 680) |
abx441883-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Synaptotagmin-12 (Syt12) Antibody (ATTO 700) |
abx442164-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Synaptotagmin-12 (Syt12) Antibody (PE/ATTO 594) |
abx443848-100ug |
Abbexa |
100 ug |
EUR 592 |
- Shipped within 5-12 working days.
|
Syt12 ORF Vector (Rat) (pORF) |
ORF077325 |
ABM |
1.0 ug DNA |
EUR 506 |
SYT12 ORF Vector (Human) (pORF) |
ORF010258 |
ABM |
1.0 ug DNA |
EUR 95 |
Syt12 ORF Vector (Mouse) (pORF) |
ORF058954 |
ABM |
1.0 ug DNA |
EUR 506 |
Human Synaptotagmin XII (SYT12)ELISA Kit |
201-12-2575 |
SunredBio |
96 tests |
EUR 440 |
- This Synaptotagmin XII ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Synaptotagmin 12 (SYT12) ELISA Kit |
abx383590-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Syt12 sgRNA CRISPR Lentivector set (Rat) |
K6942201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Syt12 sgRNA CRISPR Lentivector set (Mouse) |
K3603401 |
ABM |
3 x 1.0 ug |
EUR 339 |
SYT12 sgRNA CRISPR Lentivector set (Human) |
K2323601 |
ABM |
3 x 1.0 ug |
EUR 339 |
ELISA kit for Rat Synaptotagmin-12 (SYT12) |
KTE100155-48T |
Abbkine |
48T |
EUR 332 |
- SYT12 is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. Studies of the orthologous gene in rat have shown tha
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-12 (SYT12) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Synaptotagmin-12 (SYT12) |
KTE100155-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- SYT12 is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. Studies of the orthologous gene in rat have shown tha
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-12 (SYT12) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Synaptotagmin-12 (SYT12) |
KTE100155-96T |
Abbkine |
96T |
EUR 539 |
- SYT12 is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. Studies of the orthologous gene in rat have shown tha
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-12 (SYT12) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Syt12 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6942202 |
ABM |
1.0 ug DNA |
EUR 154 |
Syt12 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6942203 |
ABM |
1.0 ug DNA |
EUR 154 |
Syt12 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6942204 |
ABM |
1.0 ug DNA |
EUR 154 |
Syt12 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3603402 |
ABM |
1.0 ug DNA |
EUR 154 |
Syt12 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3603403 |
ABM |
1.0 ug DNA |
EUR 154 |
Syt12 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3603404 |
ABM |
1.0 ug DNA |
EUR 154 |
SYT12 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2323602 |
ABM |
1.0 ug DNA |
EUR 154 |
SYT12 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2323603 |
ABM |
1.0 ug DNA |
EUR 154 |
SYT12 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2323604 |
ABM |
1.0 ug DNA |
EUR 154 |
ELISA kit for Human Synaptotagmin-12 (SYT12) |
KTE60427-48T |
Abbkine |
48T |
EUR 332 |
- Syt12 colocalises with and binds Syt1 on synaptic vesicles, but regulates spontaneous release independently from Syt1. Syt12 is phosphorylated by cAMP-dependent protein kinase A (PKA) at a single site, and mutation of this site blocks the effect of S
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-12 (SYT12) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Synaptotagmin-12 (SYT12) |
KTE60427-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Syt12 colocalises with and binds Syt1 on synaptic vesicles, but regulates spontaneous release independently from Syt1. Syt12 is phosphorylated by cAMP-dependent protein kinase A (PKA) at a single site, and mutation of this site blocks the effect of S
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-12 (SYT12) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Synaptotagmin-12 (SYT12) |
KTE60427-96T |
Abbkine |
96T |
EUR 539 |
- Syt12 colocalises with and binds Syt1 on synaptic vesicles, but regulates spontaneous release independently from Syt1. Syt12 is phosphorylated by cAMP-dependent protein kinase A (PKA) at a single site, and mutation of this site blocks the effect of S
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-12 (SYT12) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-12 (SYT12) |
KTE70297-48T |
Abbkine |
48T |
EUR 332 |
- SYT12 is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. Studies of the orthologous gene in rat have shown tha
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-12 (SYT12) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-12 (SYT12) |
KTE70297-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- SYT12 is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. Studies of the orthologous gene in rat have shown tha
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-12 (SYT12) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-12 (SYT12) |
KTE70297-96T |
Abbkine |
96T |
EUR 539 |
- SYT12 is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. Studies of the orthologous gene in rat have shown tha
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-12 (SYT12) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
SYT12 Protein Vector (Rat) (pPB-C-His) |
PV309298 |
ABM |
500 ng |
EUR 603 |
SYT12 Protein Vector (Rat) (pPB-N-His) |
PV309299 |
ABM |
500 ng |
EUR 603 |
SYT12 Protein Vector (Rat) (pPM-C-HA) |
PV309300 |
ABM |
500 ng |
EUR 603 |
SYT12 Protein Vector (Rat) (pPM-C-His) |
PV309301 |
ABM |
500 ng |
EUR 603 |
SYT12 Protein Vector (Human) (pPB-C-His) |
PV041029 |
ABM |
500 ng |
EUR 329 |
SYT12 Protein Vector (Human) (pPB-N-His) |
PV041030 |
ABM |
500 ng |
EUR 329 |
SYT12 Protein Vector (Human) (pPM-C-HA) |
PV041031 |
ABM |
500 ng |
EUR 329 |
SYT12 Protein Vector (Human) (pPM-C-His) |
PV041032 |
ABM |
500 ng |
EUR 329 |
SYT12 Protein Vector (Mouse) (pPB-C-His) |
PV235814 |
ABM |
500 ng |
EUR 603 |
SYT12 Protein Vector (Mouse) (pPB-N-His) |
PV235815 |
ABM |
500 ng |
EUR 603 |
SYT12 Protein Vector (Mouse) (pPM-C-HA) |
PV235816 |
ABM |
500 ng |
EUR 603 |
SYT12 Protein Vector (Mouse) (pPM-C-His) |
PV235817 |
ABM |
500 ng |
EUR 603 |
Syt12 3'UTR Luciferase Stable Cell Line |
TU120038 |
ABM |
1.0 ml |
Ask for price |
Syt12 3'UTR GFP Stable Cell Line |
TU170038 |
ABM |
1.0 ml |
Ask for price |
Syt12 3'UTR Luciferase Stable Cell Line |
TU221484 |
ABM |
1.0 ml |
Ask for price |
SYT12 3'UTR GFP Stable Cell Line |
TU075032 |
ABM |
1.0 ml |
EUR 1521 |
Syt12 3'UTR GFP Stable Cell Line |
TU271484 |
ABM |
1.0 ml |
Ask for price |
SYT12 3'UTR Luciferase Stable Cell Line |
TU025032 |
ABM |
1.0 ml |
EUR 1521 |
SYT12 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV658111 |
ABM |
1.0 ug DNA |
EUR 682 |
SYT12 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV658115 |
ABM |
1.0 ug DNA |
EUR 682 |
SYT12 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV658116 |
ABM |
1.0 ug DNA |
EUR 682 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
SYT12 Rabbit Polyclonal Antibody