SYT15 Polyclonal Antibody |
ABP60573-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human SYT15 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SYT15 from Human, Mouse, Rat. This SYT15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SYT15 protein |
SYT15 Polyclonal Antibody |
ABP60573-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human SYT15 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SYT15 from Human, Mouse, Rat. This SYT15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SYT15 protein |
SYT15 Polyclonal Antibody |
ABP60573-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human SYT15 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SYT15 from Human, Mouse, Rat. This SYT15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SYT15 protein |
Anti-SYT15 antibody |
STJ191491 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to SYT15 |
SYT15 siRNA |
20-abx935847 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SYT15 siRNA |
20-abx935848 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Synaptotagmin-15 (SYT15) Antibody |
abx145897-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
SYT15 cloning plasmid |
CSB-CL874787HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1173
- Sequence: ATGGCGGAGCAGCTGGCCCTGGTGATTGGGGGCACCATCGGGGGGCTGCTGCTGCTGCTGTTGATCGGGGCAAGCTGCTGTCTGTGGAGAAGGTTCTGTGCCACCCTCACCTATGAGGAGCTGCCTGGGACACCAGCCATGGCCACCACAGCTGCCTCCAGTGGGCAGCGGGACA
- Show more
|
Description: A cloning plasmid for the SYT15 gene. |
Mouse SYT15 shRNA Plasmid |
20-abx983276 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human SYT15 shRNA Plasmid |
20-abx963198 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SYT15 Recombinant Protein (Human) |
RP043894 |
ABM |
100 ug |
Ask for price |
SYT15 Recombinant Protein (Rat) |
RP231977 |
ABM |
100 ug |
Ask for price |
SYT15 Recombinant Protein (Mouse) |
RP176867 |
ABM |
100 ug |
Ask for price |
SYT15 Recombinant Protein (Mouse) |
RP176870 |
ABM |
100 ug |
Ask for price |
Syt15 ORF Vector (Mouse) (pORF) |
ORF058957 |
ABM |
1.0 ug DNA |
EUR 506 |
Syt15 ORF Vector (Mouse) (pORF) |
ORF058958 |
ABM |
1.0 ug DNA |
EUR 506 |
Syt15 ORF Vector (Rat) (pORF) |
ORF077327 |
ABM |
1.0 ug DNA |
EUR 506 |
SYT15 ORF Vector (Human) (pORF) |
ORF014632 |
ABM |
1.0 ug DNA |
EUR 354 |
Human Synaptotagmin XV (SYT15)ELISA Kit |
201-12-2578 |
SunredBio |
96 tests |
EUR 440 |
- This Synaptotagmin XV ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
SYT15 sgRNA CRISPR Lentivector set (Human) |
K2324001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Syt15 sgRNA CRISPR Lentivector set (Mouse) |
K3174501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Syt15 sgRNA CRISPR Lentivector set (Rat) |
K7425301 |
ABM |
3 x 1.0 ug |
EUR 339 |
SYT15 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2324002 |
ABM |
1.0 ug DNA |
EUR 154 |
SYT15 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2324003 |
ABM |
1.0 ug DNA |
EUR 154 |
SYT15 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2324004 |
ABM |
1.0 ug DNA |
EUR 154 |
Syt15 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3174502 |
ABM |
1.0 ug DNA |
EUR 154 |
Syt15 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3174503 |
ABM |
1.0 ug DNA |
EUR 154 |
Syt15 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3174504 |
ABM |
1.0 ug DNA |
EUR 154 |
Syt15 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7425302 |
ABM |
1.0 ug DNA |
EUR 154 |
Syt15 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7425303 |
ABM |
1.0 ug DNA |
EUR 154 |
Syt15 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7425304 |
ABM |
1.0 ug DNA |
EUR 154 |
ELISA kit for Rat Synaptotagmin-15 (SYT15) |
KTE100157-48T |
Abbkine |
48T |
EUR 332 |
- putative calcium-independent synaptotagmin protein that participates in membrane transport [RGD, Feb 2006]
|
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-15 (SYT15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Synaptotagmin-15 (SYT15) |
KTE100157-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- putative calcium-independent synaptotagmin protein that participates in membrane transport [RGD, Feb 2006]
|
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-15 (SYT15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Synaptotagmin-15 (SYT15) |
KTE100157-96T |
Abbkine |
96T |
EUR 539 |
- putative calcium-independent synaptotagmin protein that participates in membrane transport [RGD, Feb 2006]
|
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-15 (SYT15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-15 (SYT15) |
KTE70300-48T |
Abbkine |
48T |
EUR 332 |
- SYT15 encodes a member of the Synaptotagmin (Syt) family of membrane trafficking proteins. Members of this family contain a transmembrane region and a C-terminal-type tandem C2 domain. Unlike related family members, the encoded protein may be involve
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-15 (SYT15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-15 (SYT15) |
KTE70300-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- SYT15 encodes a member of the Synaptotagmin (Syt) family of membrane trafficking proteins. Members of this family contain a transmembrane region and a C-terminal-type tandem C2 domain. Unlike related family members, the encoded protein may be involve
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-15 (SYT15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-15 (SYT15) |
KTE70300-96T |
Abbkine |
96T |
EUR 539 |
- SYT15 encodes a member of the Synaptotagmin (Syt) family of membrane trafficking proteins. Members of this family contain a transmembrane region and a C-terminal-type tandem C2 domain. Unlike related family members, the encoded protein may be involve
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-15 (SYT15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Synaptotagmin-15 (SYT15) |
KTE60430-48T |
Abbkine |
48T |
EUR 332 |
- Synaptotagmin-15 (Syt15) belongs to the synaptotagmin family, which is a group of membrane-trafficking proteins that contain two C-terminal C2 domains (known as C2A and C2B domains). Most of the synaptotagmins have a unique N-terminal domain that is
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-15 (SYT15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Synaptotagmin-15 (SYT15) |
KTE60430-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Synaptotagmin-15 (Syt15) belongs to the synaptotagmin family, which is a group of membrane-trafficking proteins that contain two C-terminal C2 domains (known as C2A and C2B domains). Most of the synaptotagmins have a unique N-terminal domain that is
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-15 (SYT15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Synaptotagmin-15 (SYT15) |
KTE60430-96T |
Abbkine |
96T |
EUR 539 |
- Synaptotagmin-15 (Syt15) belongs to the synaptotagmin family, which is a group of membrane-trafficking proteins that contain two C-terminal C2 domains (known as C2A and C2B domains). Most of the synaptotagmins have a unique N-terminal domain that is
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-15 (SYT15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
SYT15 Protein Vector (Human) (pPB-C-His) |
PV058525 |
ABM |
500 ng |
EUR 481 |
SYT15 Protein Vector (Human) (pPB-N-His) |
PV058526 |
ABM |
500 ng |
EUR 481 |
SYT15 Protein Vector (Human) (pPM-C-HA) |
PV058527 |
ABM |
500 ng |
EUR 481 |
SYT15 Protein Vector (Human) (pPM-C-His) |
PV058528 |
ABM |
500 ng |
EUR 481 |
SYT15 Protein Vector (Rat) (pPB-C-His) |
PV309306 |
ABM |
500 ng |
EUR 603 |
SYT15 Protein Vector (Rat) (pPB-N-His) |
PV309307 |
ABM |
500 ng |
EUR 603 |
SYT15 Protein Vector (Rat) (pPM-C-HA) |
PV309308 |
ABM |
500 ng |
EUR 603 |
SYT15 Protein Vector (Rat) (pPM-C-His) |
PV309309 |
ABM |
500 ng |
EUR 603 |
SYT15 Protein Vector (Mouse) (pPB-C-His) |
PV235826 |
ABM |
500 ng |
EUR 603 |
SYT15 Protein Vector (Mouse) (pPB-N-His) |
PV235827 |
ABM |
500 ng |
EUR 603 |
SYT15 Protein Vector (Mouse) (pPM-C-HA) |
PV235828 |
ABM |
500 ng |
EUR 603 |
SYT15 Protein Vector (Mouse) (pPM-C-His) |
PV235829 |
ABM |
500 ng |
EUR 603 |
SYT15 Protein Vector (Mouse) (pPB-C-His) |
PV235830 |
ABM |
500 ng |
EUR 603 |
SYT15 Protein Vector (Mouse) (pPB-N-His) |
PV235831 |
ABM |
500 ng |
EUR 603 |
SYT15 Protein Vector (Mouse) (pPM-C-HA) |
PV235832 |
ABM |
500 ng |
EUR 603 |
SYT15 Protein Vector (Mouse) (pPM-C-His) |
PV235833 |
ABM |
500 ng |
EUR 603 |
Syt15 3'UTR GFP Stable Cell Line |
TU170041 |
ABM |
1.0 ml |
Ask for price |
Syt15 3'UTR Luciferase Stable Cell Line |
TU120041 |
ABM |
1.0 ml |
Ask for price |
SYT15 3'UTR GFP Stable Cell Line |
TU075036 |
ABM |
1.0 ml |
EUR 2333 |
SYT15 3'UTR Luciferase Stable Cell Line |
TU025036 |
ABM |
1.0 ml |
EUR 2333 |
Syt15 3'UTR Luciferase Stable Cell Line |
TU221486 |
ABM |
1.0 ml |
Ask for price |
Syt15 3'UTR GFP Stable Cell Line |
TU271486 |
ABM |
1.0 ml |
Ask for price |
SYT15 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV658495 |
ABM |
1.0 ug DNA |
EUR 682 |
SYT15 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV658499 |
ABM |
1.0 ug DNA |
EUR 682 |
SYT15 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV658500 |
ABM |
1.0 ug DNA |
EUR 682 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
SYT15 Rabbit Polyclonal Antibody