SYT15 Rabbit Polyclonal Antibody

SYT15 Polyclonal Antibody

ABP60573-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human SYT15 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SYT15 from Human, Mouse, Rat. This SYT15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SYT15 protein

SYT15 Polyclonal Antibody

ABP60573-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SYT15 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SYT15 from Human, Mouse, Rat. This SYT15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SYT15 protein

SYT15 Polyclonal Antibody

ABP60573-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SYT15 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SYT15 from Human, Mouse, Rat. This SYT15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SYT15 protein

Syt15/ Rat Syt15 ELISA Kit

ELI-52195r 96 Tests
EUR 886

Anti-SYT15 antibody

STJ191491 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SYT15

SYT15 siRNA

20-abx935847
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SYT15 siRNA

20-abx935848
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Synaptotagmin-15 (SYT15) Antibody

abx145897-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

SYT15 cloning plasmid

CSB-CL874787HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1173
  • Sequence: ATGGCGGAGCAGCTGGCCCTGGTGATTGGGGGCACCATCGGGGGGCTGCTGCTGCTGCTGTTGATCGGGGCAAGCTGCTGTCTGTGGAGAAGGTTCTGTGCCACCCTCACCTATGAGGAGCTGCCTGGGACACCAGCCATGGCCACCACAGCTGCCTCCAGTGGGCAGCGGGACA
  • Show more
Description: A cloning plasmid for the SYT15 gene.

Mouse SYT15 shRNA Plasmid

20-abx983276
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SYT15 shRNA Plasmid

20-abx963198
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SYT15 Recombinant Protein (Human)

RP043894 100 ug Ask for price

SYT15 Recombinant Protein (Rat)

RP231977 100 ug Ask for price

SYT15 Recombinant Protein (Mouse)

RP176867 100 ug Ask for price

SYT15 Recombinant Protein (Mouse)

RP176870 100 ug Ask for price

Syt15 ORF Vector (Mouse) (pORF)

ORF058957 1.0 ug DNA
EUR 506

Syt15 ORF Vector (Mouse) (pORF)

ORF058958 1.0 ug DNA
EUR 506

Syt15 ORF Vector (Rat) (pORF)

ORF077327 1.0 ug DNA
EUR 506

SYT15 ORF Vector (Human) (pORF)

ORF014632 1.0 ug DNA
EUR 354

Mouse Synaptotagmin- 15, Syt15 ELISA KIT

ELI-29938m 96 Tests
EUR 865

Human Synaptotagmin- 15, SYT15 ELISA KIT

ELI-41700h 96 Tests
EUR 824

Human Synaptotagmin XV (SYT15)ELISA Kit

201-12-2578 96 tests
EUR 440
  • This Synaptotagmin XV ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

SYT15 sgRNA CRISPR Lentivector set (Human)

K2324001 3 x 1.0 ug
EUR 339

Syt15 sgRNA CRISPR Lentivector set (Mouse)

K3174501 3 x 1.0 ug
EUR 339

Syt15 sgRNA CRISPR Lentivector set (Rat)

K7425301 3 x 1.0 ug
EUR 339

Human Synaptotagmin XV(SYT15)ELISA Kit

QY-E01183 96T
EUR 361

SYT15 sgRNA CRISPR Lentivector (Human) (Target 1)

K2324002 1.0 ug DNA
EUR 154

SYT15 sgRNA CRISPR Lentivector (Human) (Target 2)

K2324003 1.0 ug DNA
EUR 154

SYT15 sgRNA CRISPR Lentivector (Human) (Target 3)

K2324004 1.0 ug DNA
EUR 154

Syt15 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3174502 1.0 ug DNA
EUR 154

Syt15 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3174503 1.0 ug DNA
EUR 154

Syt15 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3174504 1.0 ug DNA
EUR 154

Syt15 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7425302 1.0 ug DNA
EUR 154

Syt15 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7425303 1.0 ug DNA
EUR 154

Syt15 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7425304 1.0 ug DNA
EUR 154

ELISA kit for Rat Synaptotagmin-15 (SYT15)

KTE100157-48T 48T
EUR 332
  • putative calcium-independent synaptotagmin protein that participates in membrane transport [RGD, Feb 2006]
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-15 (SYT15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Synaptotagmin-15 (SYT15)

KTE100157-5platesof96wells 5 plates of 96 wells
EUR 2115
  • putative calcium-independent synaptotagmin protein that participates in membrane transport [RGD, Feb 2006]
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-15 (SYT15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Synaptotagmin-15 (SYT15)

KTE100157-96T 96T
EUR 539
  • putative calcium-independent synaptotagmin protein that participates in membrane transport [RGD, Feb 2006]
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-15 (SYT15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-15 (SYT15)

KTE70300-48T 48T
EUR 332
  • SYT15 encodes a member of the Synaptotagmin (Syt) family of membrane trafficking proteins. Members of this family contain a transmembrane region and a C-terminal-type tandem C2 domain. Unlike related family members, the encoded protein may be involve
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-15 (SYT15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-15 (SYT15)

KTE70300-5platesof96wells 5 plates of 96 wells
EUR 2115
  • SYT15 encodes a member of the Synaptotagmin (Syt) family of membrane trafficking proteins. Members of this family contain a transmembrane region and a C-terminal-type tandem C2 domain. Unlike related family members, the encoded protein may be involve
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-15 (SYT15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-15 (SYT15)

KTE70300-96T 96T
EUR 539
  • SYT15 encodes a member of the Synaptotagmin (Syt) family of membrane trafficking proteins. Members of this family contain a transmembrane region and a C-terminal-type tandem C2 domain. Unlike related family members, the encoded protein may be involve
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-15 (SYT15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-15 (SYT15)

KTE60430-48T 48T
EUR 332
  • Synaptotagmin-15 (Syt15) belongs to the synaptotagmin family, which is a group of membrane-trafficking proteins that contain two C-terminal C2 domains (known as C2A and C2B domains). Most of the synaptotagmins have a unique N-terminal domain that is
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-15 (SYT15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-15 (SYT15)

KTE60430-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Synaptotagmin-15 (Syt15) belongs to the synaptotagmin family, which is a group of membrane-trafficking proteins that contain two C-terminal C2 domains (known as C2A and C2B domains). Most of the synaptotagmins have a unique N-terminal domain that is
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-15 (SYT15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-15 (SYT15)

KTE60430-96T 96T
EUR 539
  • Synaptotagmin-15 (Syt15) belongs to the synaptotagmin family, which is a group of membrane-trafficking proteins that contain two C-terminal C2 domains (known as C2A and C2B domains). Most of the synaptotagmins have a unique N-terminal domain that is
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-15 (SYT15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

SYT15 Protein Vector (Human) (pPB-C-His)

PV058525 500 ng
EUR 481

SYT15 Protein Vector (Human) (pPB-N-His)

PV058526 500 ng
EUR 481

SYT15 Protein Vector (Human) (pPM-C-HA)

PV058527 500 ng
EUR 481

SYT15 Protein Vector (Human) (pPM-C-His)

PV058528 500 ng
EUR 481

SYT15 Protein Vector (Rat) (pPB-C-His)

PV309306 500 ng
EUR 603

SYT15 Protein Vector (Rat) (pPB-N-His)

PV309307 500 ng
EUR 603

SYT15 Protein Vector (Rat) (pPM-C-HA)

PV309308 500 ng
EUR 603

SYT15 Protein Vector (Rat) (pPM-C-His)

PV309309 500 ng
EUR 603

SYT15 Protein Vector (Mouse) (pPB-C-His)

PV235826 500 ng
EUR 603

SYT15 Protein Vector (Mouse) (pPB-N-His)

PV235827 500 ng
EUR 603

SYT15 Protein Vector (Mouse) (pPM-C-HA)

PV235828 500 ng
EUR 603

SYT15 Protein Vector (Mouse) (pPM-C-His)

PV235829 500 ng
EUR 603

SYT15 Protein Vector (Mouse) (pPB-C-His)

PV235830 500 ng
EUR 603

SYT15 Protein Vector (Mouse) (pPB-N-His)

PV235831 500 ng
EUR 603

SYT15 Protein Vector (Mouse) (pPM-C-HA)

PV235832 500 ng
EUR 603

SYT15 Protein Vector (Mouse) (pPM-C-His)

PV235833 500 ng
EUR 603

Syt15 3'UTR GFP Stable Cell Line

TU170041 1.0 ml Ask for price

Syt15 3'UTR Luciferase Stable Cell Line

TU120041 1.0 ml Ask for price

SYT15 3'UTR GFP Stable Cell Line

TU075036 1.0 ml
EUR 2333

SYT15 3'UTR Luciferase Stable Cell Line

TU025036 1.0 ml
EUR 2333

Syt15 3'UTR Luciferase Stable Cell Line

TU221486 1.0 ml Ask for price

Syt15 3'UTR GFP Stable Cell Line

TU271486 1.0 ml Ask for price

SYT15 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV658495 1.0 ug DNA
EUR 682

SYT15 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV658499 1.0 ug DNA
EUR 682

SYT15 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV658500 1.0 ug DNA
EUR 682

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

SYT15 Rabbit Polyclonal Antibody