SYT9 Rabbit Polyclonal Antibody

SYT9 Polyclonal Antibody

ES10339-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SYT9 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

SYT9 antibody

70R-20680 50 ul
EUR 435
Description: Rabbit polyclonal SYT9 antibody

SYT9 Antibody

35939-100ul 100ul
EUR 252

SYT9 Antibody

1-CSB-PA272409
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SYT9. Recognizes SYT9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

SYT9 antibody

70R-7051 50 ug
EUR 467
Description: Rabbit polyclonal SYT9 antibody raised against the middle region of SYT9

SYT9 Antibody

1-CSB-PA023045GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SYT9. Recognizes SYT9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Syt9/ Rat Syt9 ELISA Kit

ELI-41068r 96 Tests
EUR 886

SYT9 Conjugated Antibody

C35939 100ul
EUR 397

Anti-SYT9 antibody

STJ191497 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SYT9

SYT9 siRNA

20-abx905420
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SYT9 siRNA

20-abx935869
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SYT9 siRNA

20-abx935870
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Synaptotagmin 9 (SYT9) Antibody

20-abx214322
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Synaptotagmin Ix (SYT9) Antibody

20-abx115952
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Synaptotagmin 9 (SYT9) Antibody

abx146114-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Synaptotagmin-9 (Syt9) Antibody

abx432049-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Synaptotagmin-9 (Syt9) Antibody

abx445047-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.

SYT9 Blocking Peptide

33R-7008 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SYT9 antibody, catalog no. 70R-7051

SYT9 cloning plasmid

CSB-CL803111HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 960
  • Sequence: atgctggcgaaggtggtggagggagatttagctttcaaaggaggcagagatatctcagtgagcctgctgacccttgtggtcactgcctgtggtctcgctctctttggcgtgtctctcttcgtatcttggaaactctgctgggttccgtggcgagaacgaggcctgccctctggtag
  • Show more
Description: A cloning plasmid for the SYT9 gene.

SYT9 cloning plasmid

CSB-CL803111HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1476
  • Sequence: atgcccggggccagggacgcgctctgtcaccaggcgctgcagctgctggccgagctctgtgcccgtggggccctggagcacgacagctgccaggatttcatttaccacctgcgggaccgtgccagaccccggctccgcgacccagatatctcagtgagcctgctgacccttgtgg
  • Show more
Description: A cloning plasmid for the SYT9 gene.

Synaptotagmin-9 (Syt9) Antibody (ALP)

abx442444-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-9 (Syt9) Antibody (APC)

abx442725-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-9 (Syt9) Antibody (Biotin)

abx443005-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-9 (Syt9) Antibody (FITC)

abx443285-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Synaptotagmin-9 (Syt9) Antibody (HRP)

abx443566-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Synaptotagmin-9 (Syt9) Antibody (PerCP)

abx444128-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-9 (Syt9) Antibody (RPE)

abx444409-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-9 (Syt9) Antibody (Streptavidin)

abx444690-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Mouse SYT9 shRNA Plasmid

20-abx975214
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SYT9 shRNA Plasmid

20-abx965370
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat SYT9 shRNA Plasmid

20-abx986065
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SYT9 Recombinant Protein (Rat)

RP232004 100 ug Ask for price

pCMV-SPORT6-SYT9 Plasmid

PVT16874 2 ug
EUR 325

SYT9 Recombinant Protein (Human)

RP030793 100 ug Ask for price

SYT9 Recombinant Protein (Human)

RP030796 100 ug Ask for price

SYT9 Recombinant Protein (Mouse)

RP176909 100 ug Ask for price

Synaptotagmin-9 (Syt9) Antibody (ATTO 390)

abx440196-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-9 (Syt9) Antibody (ATTO 488)

abx440477-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-9 (Syt9) Antibody (ATTO 565)

abx440758-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-9 (Syt9) Antibody (ATTO 594)

abx441039-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-9 (Syt9) Antibody (ATTO 633)

abx441320-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-9 (Syt9) Antibody (ATTO 655)

abx441601-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-9 (Syt9) Antibody (ATTO 680)

abx441882-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-9 (Syt9) Antibody (ATTO 700)

abx442163-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-9 (Syt9) Antibody (PE/ATTO 594)

abx443847-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Syt9 ORF Vector (Rat) (pORF)

ORF077336 1.0 ug DNA
EUR 506

SYT9 ORF Vector (Human) (pORF)

ORF010265 1.0 ug DNA
EUR 95

SYT9 ORF Vector (Human) (pORF)

ORF010266 1.0 ug DNA
EUR 95

Syt9 ORF Vector (Mouse) (pORF)

ORF058971 1.0 ug DNA
EUR 506

Mouse Synaptotagmin- 9, Syt9 ELISA KIT

ELI-46285m 96 Tests
EUR 865

Human Synaptotagmin 9 (SYT9) ELISA Kit

abx383594-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Synaptotagmin- 9, SYT9 ELISA KIT

ELI-39805h 96 Tests
EUR 824

Syt9 sgRNA CRISPR Lentivector set (Rat)

K6855101 3 x 1.0 ug
EUR 339

Syt9 sgRNA CRISPR Lentivector set (Mouse)

K3813101 3 x 1.0 ug
EUR 339

SYT9 sgRNA CRISPR Lentivector set (Human)

K2323301 3 x 1.0 ug
EUR 339

ELISA kit for Rat Synaptotagmin-9 (SYT9)

KTE100165-48T 48T
EUR 332
  • member of a family of membrane proteins characterized by one transmembrane region and two C2 domains [RGD, Feb 2006]
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-9 (SYT9) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Synaptotagmin-9 (SYT9)

KTE100165-5platesof96wells 5 plates of 96 wells
EUR 2115
  • member of a family of membrane proteins characterized by one transmembrane region and two C2 domains [RGD, Feb 2006]
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-9 (SYT9) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Synaptotagmin-9 (SYT9)

KTE100165-96T 96T
EUR 539
  • member of a family of membrane proteins characterized by one transmembrane region and two C2 domains [RGD, Feb 2006]
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-9 (SYT9) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Syt9 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6855102 1.0 ug DNA
EUR 154

Syt9 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6855103 1.0 ug DNA
EUR 154

Syt9 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6855104 1.0 ug DNA
EUR 154

Syt9 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3813102 1.0 ug DNA
EUR 154

Syt9 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3813103 1.0 ug DNA
EUR 154

Syt9 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3813104 1.0 ug DNA
EUR 154

SYT9 sgRNA CRISPR Lentivector (Human) (Target 1)

K2323302 1.0 ug DNA
EUR 154

SYT9 sgRNA CRISPR Lentivector (Human) (Target 2)

K2323303 1.0 ug DNA
EUR 154

SYT9 sgRNA CRISPR Lentivector (Human) (Target 3)

K2323304 1.0 ug DNA
EUR 154

ELISA kit for Human Synaptotagmin-9 (SYT9)

KTE60440-48T 48T
EUR 332
  • Synaptotagmin-9 (SYT9) may be involved in Ca2+-dependent exocytosis of secretory vesicles through Ca2+ and phospholipid binding to the C2 domain or may serve as Ca2+ sensors in the process of vesicular trafficking and exocytosis.
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-9 (SYT9) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-9 (SYT9)

KTE60440-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Synaptotagmin-9 (SYT9) may be involved in Ca2+-dependent exocytosis of secretory vesicles through Ca2+ and phospholipid binding to the C2 domain or may serve as Ca2+ sensors in the process of vesicular trafficking and exocytosis.
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-9 (SYT9) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-9 (SYT9)

KTE60440-96T 96T
EUR 539
  • Synaptotagmin-9 (SYT9) may be involved in Ca2+-dependent exocytosis of secretory vesicles through Ca2+ and phospholipid binding to the C2 domain or may serve as Ca2+ sensors in the process of vesicular trafficking and exocytosis.
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-9 (SYT9) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-9 (SYT9)

KTE70310-48T 48T
EUR 332
  • SYT9 (Synaptotagmin 9) is a Protein Coding gene. Among its related pathways are Protein-protein interactions at synapses and Vesicle-mediated transport. GO annotations related to SYT9 include calcium ion binding and transporter activity. An important
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-9 (SYT9) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-9 (SYT9)

KTE70310-5platesof96wells 5 plates of 96 wells
EUR 2115
  • SYT9 (Synaptotagmin 9) is a Protein Coding gene. Among its related pathways are Protein-protein interactions at synapses and Vesicle-mediated transport. GO annotations related to SYT9 include calcium ion binding and transporter activity. An important
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-9 (SYT9) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-9 (SYT9)

KTE70310-96T 96T
EUR 539
  • SYT9 (Synaptotagmin 9) is a Protein Coding gene. Among its related pathways are Protein-protein interactions at synapses and Vesicle-mediated transport. GO annotations related to SYT9 include calcium ion binding and transporter activity. An important
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-9 (SYT9) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

SYT9 Protein Vector (Rat) (pPB-C-His)

PV309342 500 ng
EUR 603

SYT9 Protein Vector (Rat) (pPB-N-His)

PV309343 500 ng
EUR 603

SYT9 Protein Vector (Rat) (pPM-C-HA)

PV309344 500 ng
EUR 603

SYT9 Protein Vector (Rat) (pPM-C-His)

PV309345 500 ng
EUR 603

SYT9 Protein Vector (Human) (pPB-C-His)

PV041057 500 ng
EUR 329

SYT9 Protein Vector (Human) (pPB-N-His)

PV041058 500 ng
EUR 329

SYT9 Protein Vector (Human) (pPM-C-HA)

PV041059 500 ng
EUR 329

SYT9 Protein Vector (Human) (pPM-C-His)

PV041060 500 ng
EUR 329

SYT9 Protein Vector (Human) (pPB-C-His)

PV041061 500 ng
EUR 329

SYT9 Protein Vector (Human) (pPB-N-His)

PV041062 500 ng
EUR 329

SYT9 Protein Vector (Human) (pPM-C-HA)

PV041063 500 ng
EUR 329

SYT9 Protein Vector (Human) (pPM-C-His)

PV041064 500 ng
EUR 329

SYT9 Protein Vector (Mouse) (pPB-C-His)

PV235882 500 ng
EUR 603

SYT9 Protein Vector (Mouse) (pPB-N-His)

PV235883 500 ng
EUR 603

SYT9 Protein Vector (Mouse) (pPM-C-HA)

PV235884 500 ng
EUR 603

SYT9 Protein Vector (Mouse) (pPM-C-His)

PV235885 500 ng
EUR 603

Syt9 3'UTR Luciferase Stable Cell Line

TU120050 1.0 ml Ask for price

Syt9 3'UTR GFP Stable Cell Line

TU170050 1.0 ml Ask for price

Syt9 3'UTR Luciferase Stable Cell Line

TU221496 1.0 ml Ask for price

SYT9 3'UTR GFP Stable Cell Line

TU075029 1.0 ml
EUR 1521

Syt9 3'UTR GFP Stable Cell Line

TU271496 1.0 ml Ask for price

SYT9 3'UTR Luciferase Stable Cell Line

TU025029 1.0 ml
EUR 1521

SYT9 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV715617 1.0 ug DNA
EUR 316

SYT9 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV715621 1.0 ug DNA
EUR 316

SYT9 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV715622 1.0 ug DNA
EUR 316

SYT9 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV692905 1.0 ug DNA
EUR 682

SYT9 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV692909 1.0 ug DNA
EUR 682

SYT9 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV692910 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

SYT9 Rabbit Polyclonal Antibody