Biocat Net

Amine biocat 3.0

TAF12 Rabbit Polyclonal Antibody

TAF12 Polyclonal Antibody

ES10379-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TAF12 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

TAF12 Polyclonal Antibody

ES10379-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TAF12 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

TAF12 Rabbit pAb

A5421-100ul 100 ul
EUR 308

TAF12 Rabbit pAb

A5421-200ul 200 ul
EUR 459

TAF12 Rabbit pAb

A5421-20ul 20 ul
EUR 183

TAF12 Rabbit pAb

A5421-50ul 50 ul
EUR 223

TAF12 antibody

70R-20689 50 ul
EUR 435
Description: Rabbit polyclonal TAF12 antibody

TAF12 antibody

10R-10398 100 ug
EUR 435
Description: Mouse monoclonal TAF12 antibody

TAF12 Antibody

40134-100ul 100ul
EUR 252

TAF12 Antibody

1-CSB-PA624102ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TAF12. Recognizes TAF12 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

TAF12 Antibody

1-CSB-PA624102LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TAF12. Recognizes TAF12 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

TAF12 Antibody

1-CSB-PA995016
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TAF12. Recognizes TAF12 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

TAF12 Antibody

DF12175 200ul
EUR 304
Description: TAF12 antibody detects endogenous levels of TAF12.

TAF12 Antibody

1-CSB-PA247131
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TAF12. Recognizes TAF12 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

TAF12 Antibody

1-CSB-PA023079GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TAF12. Recognizes TAF12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TAF12 Polyclonal Antibody, HRP Conjugated

A56965 100 µg
EUR 570.55
Description: The best epigenetics products

TAF12 Polyclonal Antibody, FITC Conjugated

A56966 100 µg
EUR 570.55
Description: kits suitable for this type of research

TAF12 Polyclonal Antibody, Biotin Conjugated

A56967 100 µg
EUR 570.55
Description: fast delivery possible

Mouse TATA Box Binding Protein Associated Factor 12 (TAF12) ELISA Kit

DLR-TAF12-Mu-48T 48T
EUR 527
  • Should the Mouse TATA Box Binding Protein Associated Factor 12 (TAF12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse TATA Box Binding Protein Associated Factor 12 (TAF12) in samples from tissue homogenates or other biological fluids.

Mouse TATA Box Binding Protein Associated Factor 12 (TAF12) ELISA Kit

DLR-TAF12-Mu-96T 96T
EUR 688
  • Should the Mouse TATA Box Binding Protein Associated Factor 12 (TAF12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse TATA Box Binding Protein Associated Factor 12 (TAF12) in samples from tissue homogenates or other biological fluids.

Mouse TATA Box Binding Protein Associated Factor 12 (TAF12) ELISA Kit

RD-TAF12-Mu-48Tests 48 Tests
EUR 533

Mouse TATA Box Binding Protein Associated Factor 12 (TAF12) ELISA Kit

RD-TAF12-Mu-96Tests 96 Tests
EUR 740

Mouse TATA Box Binding Protein Associated Factor 12 (TAF12) ELISA Kit

RDR-TAF12-Mu-48Tests 48 Tests
EUR 557

Mouse TATA Box Binding Protein Associated Factor 12 (TAF12) ELISA Kit

RDR-TAF12-Mu-96Tests 96 Tests
EUR 774

[KO Validated] TAF12 Rabbit pAb

A18073-100ul 100 ul
EUR 410

[KO Validated] TAF12 Rabbit pAb

A18073-200ul 200 ul
EUR 571

[KO Validated] TAF12 Rabbit pAb

A18073-20ul 20 ul
EUR 221

[KO Validated] TAF12 Rabbit pAb

A18073-50ul 50 ul
EUR 287

Anti-TAF12 Antibody

A06944-1 100ug/vial
EUR 334

TAF12 Conjugated Antibody

C40134 100ul
EUR 397

anti- TAF12 antibody

FNab08478 100µg
EUR 548.75
  • Immunogen: TAF12 RNA polymerase II, TATA box binding protein(TBP)-associated factor, 20kDa
  • Uniprot ID: Q16514
  • Gene ID: 6883
  • Research Area: Metabolism
Description: Antibody raised against TAF12

Anti-TAF12 antibody

PAab08478 100 ug
EUR 386

Anti-TAF12 antibody

STJ11100046 100 µl
EUR 413
Description: Control of transcription by RNA polymerase II involves the basal transcription machinery which is a collection of proteins. These proteins with RNA polymerase II, assemble into complexes which are modulated by transactivator proteins that bind to cis-regulatory elements located adjacent to the transcription start site. Some modulators interact directly with the basal complex, whereas others may act as bridging proteins linking transactivators to the basal transcription factors. Some of these associated factors are weakly attached while others are tightly associated with TBP in the TFIID complex. Among the latter are the TAF proteins. Different TAFs are predicted to mediate the function of distinct transcriptional activators for a variety of gene promoters and RNA polymerases. TAF12 interacts directly with TBP as well as with TAF2I. Two transcript variants encoding the same protein have been found for this gene.

Anti-TAF12 antibody

STJ27374 100 µl
EUR 277
Description: Control of transcription by RNA polymerase II involves the basal transcription machinery which is a collection of proteins. These proteins with RNA polymerase II, assemble into complexes which are modulated by transactivator proteins that bind to cis-regulatory elements located adjacent to the transcription start site. Some modulators interact directly with the basal complex, whereas others may act as bridging proteins linking transactivators to the basal transcription factors. Some of these associated factors are weakly attached while others are tightly associated with TBP in the TFIID complex. Among the latter are the TAF proteins. Different TAFs are predicted to mediate the function of distinct transcriptional activators for a variety of gene promoters and RNA polymerases. TAF12 interacts directly with TBP as well as with TAF2I. Two transcript variants encoding the same protein have been found for this gene.

Anti-TAF12 antibody

STJ191537 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TAF12

TAF12 siRNA

20-abx935956
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TAF12 siRNA

20-abx935957
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-TAF12

YF-PA14903 50 ul
EUR 363
Description: Mouse polyclonal to TAF12

anti-TAF12

YF-PA14904 50 ug
EUR 363
Description: Mouse polyclonal to TAF12

TAF12 Antibody, HRP conjugated

1-CSB-PA624102LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TAF12. Recognizes TAF12 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TAF12 Antibody, FITC conjugated

1-CSB-PA624102LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TAF12. Recognizes TAF12 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TAF12 Antibody, Biotin conjugated

1-CSB-PA624102LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TAF12. Recognizes TAF12 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TAF12 Blocking Peptide

DF12175-BP 1mg
EUR 195

TAF12 cloning plasmid

CSB-CL624102HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 486
  • Sequence: atgaaccagtttggcccctcagccctaatcaacctctccaatttctcatccataaaaccggaaccagccagcacccctccacaaggctccatggccaatagtactgcagtggtaaagataccaggcactcctggggcaggaggtcgtcttagccctgaaaacaatcaggtattgac
  • Show more
Description: A cloning plasmid for the TAF12 gene.

Anti-TAF12 (1E10)

YF-MA15714 100 ug
EUR 363
Description: Mouse monoclonal to TAF12

TAF12 ELISA KIT|Human

EF003432 96 Tests
EUR 689

Bovine TAF12 ELISA KIT

ELI-46614b 96 Tests
EUR 928

Mouse TAF12 shRNA Plasmid

20-abx975625
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TAF12 shRNA Plasmid

20-abx954712
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TAF12 ELISA KIT

ELI-41687h 96 Tests
EUR 824

Mouse Taf12 ELISA KIT

ELI-41741m 96 Tests
EUR 865

TAF12 Recombinant Protein (Rat)

RP232148 100 ug Ask for price

TAF12 Recombinant Protein (Human)

RP030844 100 ug Ask for price

TAF12 Recombinant Protein (Mouse)

RP177080 100 ug Ask for price

TATA Box Binding Protein Associated Factor 12 (TAF12) Polyclonal Antibody (Human)

4-PAE562Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TAF12 (Met1~Lys161)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TATA Box Binding Protein Associated Factor 12 (TAF12)

Taf12 ORF Vector (Rat) (pORF)

ORF077384 1.0 ug DNA
EUR 506

TAF12 ORF Vector (Human) (pORF)

ORF010282 1.0 ug DNA
EUR 95

Taf12 ORF Vector (Mouse) (pORF)

ORF059028 1.0 ug DNA
EUR 506

TAF12 ELISA Kit (Mouse) (OKDD00649)

OKDD00649 96 Wells
EUR 988
Description: Description of target: Tafs are components of the transcription factor iid (tfiid) complex, pcaf histone acetylase complex and tbp-free tafii complex (tftc). tafs components-tiifd are essential for mediating regulation of rna polymerase transcription (by similarity).;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.059 ng/mL

TATA Box Binding Protein Associated Factor 12 (TAF12) Polyclonal Antibody (Human), APC

4-PAE562Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TAF12 (Met1~Lys161)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TATA Box Binding Protein Associated Factor 12 (TAF12). This antibody is labeled with APC.

TATA Box Binding Protein Associated Factor 12 (TAF12) Polyclonal Antibody (Human), Biotinylated

4-PAE562Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TAF12 (Met1~Lys161)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TATA Box Binding Protein Associated Factor 12 (TAF12). This antibody is labeled with Biotin.

TATA Box Binding Protein Associated Factor 12 (TAF12) Polyclonal Antibody (Human), Cy3

4-PAE562Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TAF12 (Met1~Lys161)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TATA Box Binding Protein Associated Factor 12 (TAF12). This antibody is labeled with Cy3.

TATA Box Binding Protein Associated Factor 12 (TAF12) Polyclonal Antibody (Human), FITC

4-PAE562Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TAF12 (Met1~Lys161)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TATA Box Binding Protein Associated Factor 12 (TAF12). This antibody is labeled with FITC.

TATA Box Binding Protein Associated Factor 12 (TAF12) Polyclonal Antibody (Human), HRP

4-PAE562Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TAF12 (Met1~Lys161)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TATA Box Binding Protein Associated Factor 12 (TAF12). This antibody is labeled with HRP.

TATA Box Binding Protein Associated Factor 12 (TAF12) Polyclonal Antibody (Human), PE

4-PAE562Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TAF12 (Met1~Lys161)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TATA Box Binding Protein Associated Factor 12 (TAF12). This antibody is labeled with PE.

Taf12 sgRNA CRISPR Lentivector set (Rat)

K6649001 3 x 1.0 ug
EUR 339

Taf12 sgRNA CRISPR Lentivector set (Mouse)

K4589101 3 x 1.0 ug
EUR 339

TAF12 sgRNA CRISPR Lentivector set (Human)

K2329601 3 x 1.0 ug
EUR 339

TATA Box Binding Protein Associated Factor 12 (TAF12) Polyclonal Antibody (Human), APC-Cy7

4-PAE562Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TAF12 (Met1~Lys161)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TATA Box Binding Protein Associated Factor 12 (TAF12). This antibody is labeled with APC-Cy7.

TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody

20-abx006778
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody

abx018184-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody

20-abx178539
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody

20-abx178540
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody

20-abx212678
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody

20-abx212679
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody

20-abx104421
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody

20-abx115978
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody

abx238478-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody

20-abx320667
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody

20-abx301395
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Taf12 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6649002 1.0 ug DNA
EUR 154

Taf12 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6649003 1.0 ug DNA
EUR 154

Taf12 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6649004 1.0 ug DNA
EUR 154

Taf12 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4589102 1.0 ug DNA
EUR 154

Taf12 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4589103 1.0 ug DNA
EUR 154

Taf12 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4589104 1.0 ug DNA
EUR 154

TAF12 sgRNA CRISPR Lentivector (Human) (Target 1)

K2329602 1.0 ug DNA
EUR 154

TAF12 sgRNA CRISPR Lentivector (Human) (Target 2)

K2329603 1.0 ug DNA
EUR 154

TAF12 sgRNA CRISPR Lentivector (Human) (Target 3)

K2329604 1.0 ug DNA
EUR 154

TAF12 Protein Vector (Rat) (pPB-C-His)

PV309534 500 ng
EUR 603

TAF12 Protein Vector (Rat) (pPB-N-His)

PV309535 500 ng
EUR 603

TAF12 Protein Vector (Rat) (pPM-C-HA)

PV309536 500 ng
EUR 603

TAF12 Protein Vector (Rat) (pPM-C-His)

PV309537 500 ng
EUR 603

TAF12 Protein Vector (Human) (pPB-C-His)

PV041125 500 ng
EUR 329

TAF12 Protein Vector (Human) (pPB-N-His)

PV041126 500 ng
EUR 329

TAF12 Protein Vector (Human) (pPM-C-HA)

PV041127 500 ng
EUR 329

TAF12 Protein Vector (Human) (pPM-C-His)

PV041128 500 ng
EUR 329

TAF12 Protein Vector (Mouse) (pPB-C-His)

PV236110 500 ng
EUR 603

TAF12 Protein Vector (Mouse) (pPB-N-His)

PV236111 500 ng
EUR 603

TAF12 Protein Vector (Mouse) (pPM-C-HA)

PV236112 500 ng
EUR 603

TAF12 Protein Vector (Mouse) (pPM-C-His)

PV236113 500 ng
EUR 603

Taf12 3'UTR Luciferase Stable Cell Line

TU120096 1.0 ml Ask for price

Taf12 3'UTR GFP Stable Cell Line

TU170096 1.0 ml Ask for price

Taf12 3'UTR Luciferase Stable Cell Line

TU221541 1.0 ml Ask for price

TAF12 3'UTR GFP Stable Cell Line

TU075101 1.0 ml
EUR 1394

Taf12 3'UTR GFP Stable Cell Line

TU271541 1.0 ml Ask for price

TAF12 3'UTR Luciferase Stable Cell Line

TU025101 1.0 ml
EUR 1394

TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody (HRP)

20-abx307129
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody (FITC)

20-abx307130
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody (Biotin)

20-abx307131
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

TAF12 Rabbit Polyclonal Antibody