 TAF12 Polyclonal Antibody |
|
ABP60607-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human TAF12 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of TAF12 from Human, Mouse. This TAF12 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TAF12 protein |
TAF12 Polyclonal Antibody |
|
A56964 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: Ask the seller for details |
 TAF12 Rabbit pAb |
|
A5421-100ul |
Abclonal |
100 ul |
EUR 308 |
TAF12 Rabbit pAb |
|
A5421-200ul |
Abclonal |
200 ul |
EUR 459 |
TAF12 Rabbit pAb |
|
A5421-20ul |
Abclonal |
20 ul |
EUR 183 |
TAF12 Rabbit pAb |
|
A5421-50ul |
Abclonal |
50 ul |
EUR 223 |
 TAF12 antibody |
|
70R-20689 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal TAF12 antibody |
 TAF12 Antibody |
|
40134-100ul |
SAB |
100ul |
EUR 252 |
TAF12 antibody |
|
10R-10398 |
Fitzgerald |
100 ug |
EUR 435 |
|
Description: Mouse monoclonal TAF12 antibody |
TAF12 Antibody |
|
1-CSB-PA995016 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against TAF12. Recognizes TAF12 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
TAF12 Antibody |
|
DF12175 |
Affbiotech |
200ul |
EUR 304 |
|
Description: TAF12 antibody detects endogenous levels of TAF12. |
TAF12 Antibody |
|
1-CSB-PA624102ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against TAF12. Recognizes TAF12 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
TAF12 Antibody |
|
1-CSB-PA624102LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against TAF12. Recognizes TAF12 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
TAF12 Antibody |
|
1-CSB-PA247131 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against TAF12. Recognizes TAF12 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
TAF12 Antibody |
|
1-CSB-PA023079GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against TAF12. Recognizes TAF12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
 TAF12 Polyclonal Antibody, HRP Conjugated |
|
A56965 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 TAF12 Polyclonal Antibody, FITC Conjugated |
|
A56966 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: kits suitable for this type of research |
 TAF12 Polyclonal Antibody, Biotin Conjugated |
|
A56967 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: fast delivery possible |
 ELISA Kit) Mouse TATA Box Binding Protein Associated Factor 12 (TAF12) ELISA Kit |
|
DLR-TAF12-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse TATA Box Binding Protein Associated Factor 12 (TAF12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse TATA Box Binding Protein Associated Factor 12 (TAF12) in samples from tissue homogenates or other biological fluids. |
Mouse TATA Box Binding Protein Associated Factor 12 (TAF12) ELISA Kit |
|
DLR-TAF12-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse TATA Box Binding Protein Associated Factor 12 (TAF12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse TATA Box Binding Protein Associated Factor 12 (TAF12) in samples from tissue homogenates or other biological fluids. |
Mouse TATA Box Binding Protein Associated Factor 12 (TAF12) ELISA Kit |
|
RD-TAF12-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse TATA Box Binding Protein Associated Factor 12 (TAF12) ELISA Kit |
|
RD-TAF12-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Mouse TATA Box Binding Protein Associated Factor 12 (TAF12) ELISA Kit |
|
RDR-TAF12-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse TATA Box Binding Protein Associated Factor 12 (TAF12) ELISA Kit |
|
RDR-TAF12-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
 [KO Validated] TAF12 Rabbit pAb |
|
A18073-100ul |
Abclonal |
100 ul |
EUR 410 |
[KO Validated] TAF12 Rabbit pAb |
|
A18073-200ul |
Abclonal |
200 ul |
EUR 571 |
[KO Validated] TAF12 Rabbit pAb |
|
A18073-20ul |
Abclonal |
20 ul |
EUR 221 |
[KO Validated] TAF12 Rabbit pAb |
|
A18073-50ul |
Abclonal |
50 ul |
EUR 287 |
 TAF12 Conjugated Antibody |
|
C40134 |
SAB |
100ul |
EUR 397 |
 anti- TAF12 antibody |
|
FNab08478 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: TAF12 RNA polymerase II, TATA box binding protein(TBP)-associated factor, 20kDa
- Uniprot ID: Q16514
- Gene ID: 6883
- Research Area: Metabolism
|
|
Description: Antibody raised against TAF12 |
 Anti-TAF12 Antibody |
|
A06944-1 |
BosterBio |
100ug/vial |
EUR 334 |
 Anti-TAF12 antibody |
|
STJ11100046 |
St John's Laboratory |
100 µl |
EUR 413 |
|
Description: Control of transcription by RNA polymerase II involves the basal transcription machinery which is a collection of proteins. These proteins with RNA polymerase II, assemble into complexes which are modulated by transactivator proteins that bind to cis-regulatory elements located adjacent to the transcription start site. Some modulators interact directly with the basal complex, whereas others may act as bridging proteins linking transactivators to the basal transcription factors. Some of these associated factors are weakly attached while others are tightly associated with TBP in the TFIID complex. Among the latter are the TAF proteins. Different TAFs are predicted to mediate the function of distinct transcriptional activators for a variety of gene promoters and RNA polymerases. TAF12 interacts directly with TBP as well as with TAF2I. Two transcript variants encoding the same protein have been found for this gene. |
Anti-TAF12 antibody |
|
STJ27374 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: Control of transcription by RNA polymerase II involves the basal transcription machinery which is a collection of proteins. These proteins with RNA polymerase II, assemble into complexes which are modulated by transactivator proteins that bind to cis-regulatory elements located adjacent to the transcription start site. Some modulators interact directly with the basal complex, whereas others may act as bridging proteins linking transactivators to the basal transcription factors. Some of these associated factors are weakly attached while others are tightly associated with TBP in the TFIID complex. Among the latter are the TAF proteins. Different TAFs are predicted to mediate the function of distinct transcriptional activators for a variety of gene promoters and RNA polymerases. TAF12 interacts directly with TBP as well as with TAF2I. Two transcript variants encoding the same protein have been found for this gene. |
Anti-TAF12 antibody |
|
STJ191537 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to TAF12 |
 TAF12 siRNA |
|
20-abx935956 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TAF12 siRNA |
|
20-abx935957 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-TAF12 |
|
YF-PA14903 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to TAF12 |
anti-TAF12 |
|
YF-PA14904 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to TAF12 |
 TAF12 Antibody, HRP conjugated |
|
1-CSB-PA624102LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against TAF12. Recognizes TAF12 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 TAF12 Antibody, FITC conjugated |
|
1-CSB-PA624102LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against TAF12. Recognizes TAF12 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 TAF12 Antibody, Biotin conjugated |
|
1-CSB-PA624102LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against TAF12. Recognizes TAF12 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 TAF12 Blocking Peptide |
|
DF12175-BP |
Affbiotech |
1mg |
EUR 195 |
 TAF12 cloning plasmid |
|
CSB-CL624102HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 486
- Sequence: atgaaccagtttggcccctcagccctaatcaacctctccaatttctcatccataaaaccggaaccagccagcacccctccacaaggctccatggccaatagtactgcagtggtaaagataccaggcactcctggggcaggaggtcgtcttagccctgaaaacaatcaggtattgac
- Show more
|
|
Description: A cloning plasmid for the TAF12 gene. |
) Anti-TAF12 (1E10) |
|
YF-MA15714 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to TAF12 |
 Mouse TAF12 shRNA Plasmid |
|
20-abx975625 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human TAF12 shRNA Plasmid |
|
20-abx954712 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) TAF12 Recombinant Protein (Human) |
|
RP030844 |
ABM |
100 ug |
Ask for price |
) TAF12 Recombinant Protein (Rat) |
|
RP232148 |
ABM |
100 ug |
Ask for price |
) TAF12 Recombinant Protein (Mouse) |
|
RP177080 |
ABM |
100 ug |
Ask for price |
 Polyclonal Antibody (Human)) TATA Box Binding Protein Associated Factor 12 (TAF12) Polyclonal Antibody (Human) |
|
4-PAE562Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TAF12 (Met1~Lys161)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human TATA Box Binding Protein Associated Factor 12 (TAF12) |
 (pORF)) Taf12 ORF Vector (Mouse) (pORF) |
|
ORF059028 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) TAF12 ORF Vector (Human) (pORF) |
|
ORF010282 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Taf12 ORF Vector (Rat) (pORF) |
|
ORF077384 |
ABM |
1.0 ug DNA |
EUR 506 |
 (OKDD00649)) TAF12 ELISA Kit (Mouse) (OKDD00649) |
|
OKDD00649 |
Aviva Systems Biology |
96 Wells |
EUR 988 |
|
Description: Description of target: Tafs are components of the transcription factor iid (tfiid) complex, pcaf histone acetylase complex and tbp-free tafii complex (tftc). tafs components-tiifd are essential for mediating regulation of rna polymerase transcription (by similarity).;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.059 ng/mL |
 Polyclonal Antibody (Human), APC) TATA Box Binding Protein Associated Factor 12 (TAF12) Polyclonal Antibody (Human), APC |
|
4-PAE562Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TAF12 (Met1~Lys161)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human TATA Box Binding Protein Associated Factor 12 (TAF12). This antibody is labeled with APC. |
 Polyclonal Antibody (Human), Biotinylated) TATA Box Binding Protein Associated Factor 12 (TAF12) Polyclonal Antibody (Human), Biotinylated |
|
4-PAE562Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TAF12 (Met1~Lys161)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human TATA Box Binding Protein Associated Factor 12 (TAF12). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human), Cy3) TATA Box Binding Protein Associated Factor 12 (TAF12) Polyclonal Antibody (Human), Cy3 |
|
4-PAE562Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TAF12 (Met1~Lys161)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human TATA Box Binding Protein Associated Factor 12 (TAF12). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human), FITC) TATA Box Binding Protein Associated Factor 12 (TAF12) Polyclonal Antibody (Human), FITC |
|
4-PAE562Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TAF12 (Met1~Lys161)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human TATA Box Binding Protein Associated Factor 12 (TAF12). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human), HRP) TATA Box Binding Protein Associated Factor 12 (TAF12) Polyclonal Antibody (Human), HRP |
|
4-PAE562Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TAF12 (Met1~Lys161)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human TATA Box Binding Protein Associated Factor 12 (TAF12). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human), PE) TATA Box Binding Protein Associated Factor 12 (TAF12) Polyclonal Antibody (Human), PE |
|
4-PAE562Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TAF12 (Met1~Lys161)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human TATA Box Binding Protein Associated Factor 12 (TAF12). This antibody is labeled with PE. |
) TAF12 sgRNA CRISPR Lentivector set (Human) |
|
K2329601 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Taf12 sgRNA CRISPR Lentivector set (Mouse) |
|
K4589101 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Taf12 sgRNA CRISPR Lentivector set (Rat) |
|
K6649001 |
ABM |
3 x 1.0 ug |
EUR 339 |
 Polyclonal Antibody (Human), APC-Cy7) TATA Box Binding Protein Associated Factor 12 (TAF12) Polyclonal Antibody (Human), APC-Cy7 |
|
4-PAE562Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TAF12 (Met1~Lys161)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human TATA Box Binding Protein Associated Factor 12 (TAF12). This antibody is labeled with APC-Cy7. |
 Antibody) TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody |
|
20-abx115978 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody |
|
20-abx104421 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody |
|
20-abx006778 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody |
|
abx018184-100ug |
Abbexa |
100 ug |
EUR 384 |
- Shipped within 5-10 working days.
|
TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody |
|
20-abx320667 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody |
|
abx238478-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody |
|
20-abx301395 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody |
|
20-abx178539 |
Abbexa |
|
|
|
|
TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody |
|
20-abx178540 |
Abbexa |
|
|
|
|
TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody |
|
20-abx212678 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody |
|
20-abx212679 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 (Target 1)) TAF12 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2329602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) TAF12 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2329603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) TAF12 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2329604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Taf12 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4589102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Taf12 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4589103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Taf12 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4589104 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Taf12 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6649002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Taf12 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6649003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Taf12 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6649004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) TAF12 Protein Vector (Human) (pPB-C-His) |
|
PV041125 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) TAF12 Protein Vector (Human) (pPB-N-His) |
|
PV041126 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) TAF12 Protein Vector (Human) (pPM-C-HA) |
|
PV041127 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) TAF12 Protein Vector (Human) (pPM-C-His) |
|
PV041128 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) TAF12 Protein Vector (Rat) (pPB-C-His) |
|
PV309534 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) TAF12 Protein Vector (Rat) (pPB-N-His) |
|
PV309535 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) TAF12 Protein Vector (Rat) (pPM-C-HA) |
|
PV309536 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) TAF12 Protein Vector (Rat) (pPM-C-His) |
|
PV309537 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) TAF12 Protein Vector (Mouse) (pPB-C-His) |
|
PV236110 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) TAF12 Protein Vector (Mouse) (pPB-N-His) |
|
PV236111 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) TAF12 Protein Vector (Mouse) (pPM-C-HA) |
|
PV236112 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) TAF12 Protein Vector (Mouse) (pPM-C-His) |
|
PV236113 |
ABM |
500 ng |
EUR 603 |
 Taf12 3'UTR GFP Stable Cell Line |
|
TU170096 |
ABM |
1.0 ml |
Ask for price |
 Taf12 3'UTR Luciferase Stable Cell Line |
|
TU120096 |
ABM |
1.0 ml |
Ask for price |
 TAF12 3'UTR GFP Stable Cell Line |
|
TU075101 |
ABM |
1.0 ml |
EUR 1394 |
 TAF12 3'UTR Luciferase Stable Cell Line |
|
TU025101 |
ABM |
1.0 ml |
EUR 1394 |
Taf12 3'UTR Luciferase Stable Cell Line |
|
TU221541 |
ABM |
1.0 ml |
Ask for price |
Taf12 3'UTR GFP Stable Cell Line |
|
TU271541 |
ABM |
1.0 ml |
Ask for price |
 Antibody (HRP)) TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody (HRP) |
|
20-abx307129 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody (FITC) |
|
20-abx307130 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) TATA Box Binding Protein Associated Factor 12 (TAF12) Antibody (Biotin) |
|
20-abx307131 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
TAF12 Rabbit Polyclonal Antibody
