TBCB Rabbit Polyclonal Antibody

TBCB Polyclonal Antibody

ABP60629-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TBCB protein
  • Applications tips:
Description: A polyclonal antibody for detection of TBCB from Human, Mouse. This TBCB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TBCB protein

TBCB Polyclonal Antibody

ABP60629-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TBCB protein
  • Applications tips:
Description: A polyclonal antibody for detection of TBCB from Human, Mouse. This TBCB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TBCB protein

TBCB Polyclonal Antibody

A61254 100 µg
EUR 570.55
Description: kits suitable for this type of research

TBCB Rabbit pAb

A3789-100ul 100 ul
EUR 308

TBCB Rabbit pAb

A3789-200ul 200 ul
EUR 459

TBCB Rabbit pAb

A3789-20ul 20 ul Ask for price

TBCB Rabbit pAb

A3789-50ul 50 ul Ask for price

TBCB Rabbit pAb

A13012-100ul 100 ul
EUR 308

TBCB Rabbit pAb

A13012-200ul 200 ul
EUR 459

TBCB Rabbit pAb

A13012-20ul 20 ul
EUR 183

TBCB Rabbit pAb

A13012-50ul 50 ul
EUR 223

TBCB Rabbit pAb

A13248-100ul 100 ul
EUR 308

TBCB Rabbit pAb

A13248-200ul 200 ul
EUR 459

TBCB Rabbit pAb

A13248-20ul 20 ul
EUR 183

TBCB Rabbit pAb

A13248-50ul 50 ul
EUR 223

TBCB antibody

70R-3673 50 ug
EUR 467
Description: Rabbit polyclonal TBCB antibody raised against the C terminal of TBCB

TBCB antibody

70R-20714 50 ul
EUR 435
Description: Rabbit polyclonal TBCB antibody

TBCB antibody

70R-9129 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TBCB antibody

TBCB Antibody

46681-100ul 100ul
EUR 252

TBCB antibody

10R-10259 50 ul
EUR 219
Description: Mouse monoclonal TBCB antibody

TBCB Antibody

1-CSB-PA023226GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TBCB. Recognizes TBCB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

TBCB Antibody

1-CSB-PA03169A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBCB. Recognizes TBCB from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000

Polyclonal TBCB Antibody (N-term)

APR13711G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TBCB (N-term). This antibody is tested and proven to work in the following applications:

TBCB Polyclonal Antibody, Biotin Conjugated

A61255 100 µg
EUR 570.55
Description: fast delivery possible

TBCB Polyclonal Antibody, FITC Conjugated

A61256 100 µg
EUR 570.55
Description: reagents widely cited

TBCB Polyclonal Antibody, HRP Conjugated

A61257 100 µg
EUR 570.55
Description: Ask the seller for details

TBCB Conjugated Antibody

C46681 100ul
EUR 397

anti- TBCB antibody

FNab08517 100µg
EUR 548.75
  • Immunogen: tubulin folding cofactor B
  • Uniprot ID: Q99426
  • Gene ID: 1155
  • Research Area: Neuroscience, Metabolism, Developmental biology
Description: Antibody raised against TBCB

Anti-TBCB antibody

PAab08517 100 ug
EUR 386

Anti-TBCB antibody

STJ25779 100 µl
EUR 277

Anti-TBCB antibody

STJ114979 100 µl
EUR 277

Anti-TBCB antibody

STJ115213 100 µl
EUR 277

Anti-TBCB antibody

STJ191559 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TBCB

TBCB siRNA

20-abx936213
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TBCB siRNA

20-abx936214
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TBCB Antibody, HRP conjugated

1-CSB-PA03169B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBCB. Recognizes TBCB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TBCB Antibody, FITC conjugated

1-CSB-PA03169C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBCB. Recognizes TBCB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TBCB Antibody, Biotin conjugated

1-CSB-PA03169D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBCB. Recognizes TBCB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TBCB Blocking Peptide

33R-10065 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TBCB antibody, catalog no. 70R-3673

Tbcb Blocking Peptide

33R-2942 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Tbcb antibody, catalog no. 70R-9129

TBCB cloning plasmid

CSB-CL859929HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 735
  • Sequence: atggaggtgacgggggtgtcggcacccacggtgaccgttttcatcagcagctccctcaacaccttccgctccgagaagcgatacagccgcagcctcaccatcgctgagttcaagtgtaaactggagttgctggtgggcagccctgcttcctgcatggaactggagctgtatggagt
  • Show more
Description: A cloning plasmid for the TBCB gene.

Mouse TBCB shRNA Plasmid

20-abx975596
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TBCB ELISA KIT|Human

EF003469 96 Tests
EUR 689

Human TBCB shRNA Plasmid

20-abx950829
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TBCB protein (His tag)

80R-2321 100 ug
EUR 322
Description: Purified recombinant Human TBCB Protein (His tag)

TBCB Recombinant Protein (Human)

RP031033 100 ug Ask for price

TBCB Recombinant Protein (Rat)

RP232457 100 ug Ask for price

TBCB Recombinant Protein (Mouse)

RP177578 100 ug Ask for price

Tubulin Folding Cofactor B (TBCB) Antibody

20-abx116336
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tubulin Folding Cofactor B (TBCB) Antibody

20-abx002740
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Tubulin Folding Cofactor B (TBCB) Antibody

abx030766-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Tubulin Folding Cofactor B (TBCB) Antibody

abx030766-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tubulin Folding Cofactor B (TBCB) Antibody

20-abx317904
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tubulin Folding Cofactor B (TBCB) Antibody

abx238517-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Tubulin Folding Cofactor B (TBCB) Antibody (HRP)

20-abx306301
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tubulin Folding Cofactor B (TBCB) Antibody (FITC)

20-abx306302
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tubulin Folding Cofactor B (TBCB) Antibody (Biotin)

20-abx306303
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tbcb ORF Vector (Mouse) (pORF)

ORF059194 1.0 ug DNA
EUR 506

TBCB ORF Vector (Human) (pORF)

ORF010345 1.0 ug DNA
EUR 95

Tbcb ORF Vector (Rat) (pORF)

ORF077487 1.0 ug DNA
EUR 506

Tubulin Folding Cofactor B (TBCB) Protein

20-abx260902
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.

TBCB sgRNA CRISPR Lentivector set (Human)

K2342201 3 x 1.0 ug
EUR 339

Tbcb sgRNA CRISPR Lentivector set (Mouse)

K4579101 3 x 1.0 ug
EUR 339

Tbcb sgRNA CRISPR Lentivector set (Rat)

K6648801 3 x 1.0 ug
EUR 339

Recombinant Tubulin Folding Cofactor B (TBCB)

4-RPE725Hu01
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q99426
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.0kDa
  • Isoelectric Point: 5.1
Description: Recombinant Human Tubulin Folding Cofactor B expressed in: E.coli

Recombinant Tubulin Folding Cofactor B (TBCB)

4-RPE725Mu01
  • EUR 395.68
  • EUR 209.00
  • EUR 1208.80
  • EUR 469.60
  • EUR 839.20
  • EUR 328.00
  • EUR 2872.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9D1E6
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.1kDa
  • Isoelectric Point: 5.1
Description: Recombinant Mouse Tubulin Folding Cofactor B expressed in: E.coli

Human Tubulin Folding Cofactor B (TBCB) Protein

20-abx650900
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Tubulin Folding Cofactor B (TBCB) Protein

20-abx650901
  • EUR 565.00
  • EUR 258.00
  • EUR 1636.00
  • EUR 662.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

TBCB sgRNA CRISPR Lentivector (Human) (Target 1)

K2342202 1.0 ug DNA
EUR 154

TBCB sgRNA CRISPR Lentivector (Human) (Target 2)

K2342203 1.0 ug DNA
EUR 154

TBCB sgRNA CRISPR Lentivector (Human) (Target 3)

K2342204 1.0 ug DNA
EUR 154

Tbcb sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4579102 1.0 ug DNA
EUR 154

Tbcb sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4579103 1.0 ug DNA
EUR 154

Tbcb sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4579104 1.0 ug DNA
EUR 154

Tbcb sgRNA CRISPR Lentivector (Rat) (Target 1)

K6648802 1.0 ug DNA
EUR 154

Tbcb sgRNA CRISPR Lentivector (Rat) (Target 2)

K6648803 1.0 ug DNA
EUR 154

Tbcb sgRNA CRISPR Lentivector (Rat) (Target 3)

K6648804 1.0 ug DNA
EUR 154

TBCB Protein Vector (Human) (pPB-C-His)

PV041377 500 ng
EUR 329

TBCB Protein Vector (Human) (pPB-N-His)

PV041378 500 ng
EUR 329

TBCB Protein Vector (Human) (pPM-C-HA)

PV041379 500 ng
EUR 329

TBCB Protein Vector (Human) (pPM-C-His)

PV041380 500 ng
EUR 329

Recombinant Human TBCB Protein, His, E.coli-1mg

QP13696-1mg 1mg
EUR 2757

Recombinant Human TBCB Protein, His, E.coli-25ug

QP13696-25ug 25ug
EUR 201

Recombinant Human TBCB Protein, His, E.coli-5ug

QP13696-5ug 5ug
EUR 155

TBCB Protein Vector (Rat) (pPB-C-His)

PV309946 500 ng
EUR 603

TBCB Protein Vector (Rat) (pPB-N-His)

PV309947 500 ng
EUR 603

TBCB Protein Vector (Rat) (pPM-C-HA)

PV309948 500 ng
EUR 603

TBCB Protein Vector (Rat) (pPM-C-His)

PV309949 500 ng
EUR 603

TBCB Protein Vector (Mouse) (pPB-C-His)

PV236774 500 ng
EUR 603

TBCB Protein Vector (Mouse) (pPB-N-His)

PV236775 500 ng
EUR 603

TBCB Protein Vector (Mouse) (pPM-C-HA)

PV236776 500 ng
EUR 603

TBCB Protein Vector (Mouse) (pPM-C-His)

PV236777 500 ng
EUR 603

Tbcb 3'UTR GFP Stable Cell Line

TU170217 1.0 ml Ask for price

Tbcb 3'UTR Luciferase Stable Cell Line

TU120217 1.0 ml Ask for price

TBCB 3'UTR GFP Stable Cell Line

TU075226 1.0 ml
EUR 1394

TBCB 3'UTR Luciferase Stable Cell Line

TU025226 1.0 ml
EUR 1394

Tbcb 3'UTR Luciferase Stable Cell Line

TU221647 1.0 ml Ask for price

Tbcb 3'UTR GFP Stable Cell Line

TU271647 1.0 ml Ask for price

Bovine Tubulin- folding cofactor B, TBCB ELISA KIT

ELI-18850b 96 Tests
EUR 928

Mouse Tubulin- folding cofactor B, Tbcb ELISA KIT

ELI-52876m 96 Tests
EUR 865

Human Tubulin- folding cofactor B, TBCB ELISA KIT

ELI-39704h 96 Tests
EUR 824

Human Tubulin Folding Cofactor B (TBCB) ELISA Kit

abx383647-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

TBCB Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV622027 1.0 ug DNA
EUR 514

TBCB Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV622031 1.0 ug DNA
EUR 514

TBCB Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV622032 1.0 ug DNA
EUR 514

TBCB Tubulin Folding Cofactor B Human Recombinant Protein

PROTQ99426 Regular: 25ug
EUR 317
Description: TBCB Human Recombinant produced in E. coli is a single polypeptide chain containing 268 amino acids (1-244) and having a molecular mass of 29.9 kDa.;TBCB is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

TBCB Rabbit Polyclonal Antibody