TBCB Polyclonal Antibody |
ABP60629-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human TBCB protein
- Applications tips:
|
Description: A polyclonal antibody for detection of TBCB from Human, Mouse. This TBCB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TBCB protein |
TBCB Polyclonal Antibody |
ABP60629-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human TBCB protein
- Applications tips:
|
Description: A polyclonal antibody for detection of TBCB from Human, Mouse. This TBCB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TBCB protein |
TBCB Polyclonal Antibody |
A61254 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
TBCB Rabbit pAb |
A3789-100ul |
Abclonal |
100 ul |
EUR 308 |
TBCB Rabbit pAb |
A3789-200ul |
Abclonal |
200 ul |
EUR 459 |
TBCB Rabbit pAb |
A3789-20ul |
Abclonal |
20 ul |
Ask for price |
TBCB Rabbit pAb |
A3789-50ul |
Abclonal |
50 ul |
Ask for price |
TBCB Rabbit pAb |
A13012-100ul |
Abclonal |
100 ul |
EUR 308 |
TBCB Rabbit pAb |
A13012-200ul |
Abclonal |
200 ul |
EUR 459 |
TBCB Rabbit pAb |
A13012-20ul |
Abclonal |
20 ul |
EUR 183 |
TBCB Rabbit pAb |
A13012-50ul |
Abclonal |
50 ul |
EUR 223 |
TBCB Rabbit pAb |
A13248-100ul |
Abclonal |
100 ul |
EUR 308 |
TBCB Rabbit pAb |
A13248-200ul |
Abclonal |
200 ul |
EUR 459 |
TBCB Rabbit pAb |
A13248-20ul |
Abclonal |
20 ul |
EUR 183 |
TBCB Rabbit pAb |
A13248-50ul |
Abclonal |
50 ul |
EUR 223 |
TBCB antibody |
70R-3673 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal TBCB antibody raised against the C terminal of TBCB |
TBCB antibody |
70R-20714 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal TBCB antibody |
TBCB antibody |
70R-9129 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal TBCB antibody |
TBCB Antibody |
46681-100ul |
SAB |
100ul |
EUR 252 |
TBCB antibody |
10R-10259 |
Fitzgerald |
50 ul |
EUR 219 |
Description: Mouse monoclonal TBCB antibody |
TBCB Antibody |
1-CSB-PA023226GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against TBCB. Recognizes TBCB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF |
TBCB Antibody |
1-CSB-PA03169A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TBCB. Recognizes TBCB from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000 |
Polyclonal TBCB Antibody (N-term) |
APR13711G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TBCB (N-term). This antibody is tested and proven to work in the following applications: |
TBCB Polyclonal Antibody, Biotin Conjugated |
A61255 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
TBCB Polyclonal Antibody, FITC Conjugated |
A61256 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
TBCB Polyclonal Antibody, HRP Conjugated |
A61257 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
TBCB Conjugated Antibody |
C46681 |
SAB |
100ul |
EUR 397 |
anti- TBCB antibody |
FNab08517 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: tubulin folding cofactor B
- Uniprot ID: Q99426
- Gene ID: 1155
- Research Area: Neuroscience, Metabolism, Developmental biology
|
Description: Antibody raised against TBCB |
Anti-TBCB antibody |
STJ191559 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to TBCB |
TBCB siRNA |
20-abx936213 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TBCB siRNA |
20-abx936214 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TBCB Antibody, HRP conjugated |
1-CSB-PA03169B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TBCB. Recognizes TBCB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
TBCB Antibody, FITC conjugated |
1-CSB-PA03169C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TBCB. Recognizes TBCB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
TBCB Antibody, Biotin conjugated |
1-CSB-PA03169D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TBCB. Recognizes TBCB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
TBCB Blocking Peptide |
33R-10065 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TBCB antibody, catalog no. 70R-3673 |
Tbcb Blocking Peptide |
33R-2942 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Tbcb antibody, catalog no. 70R-9129 |
TBCB cloning plasmid |
CSB-CL859929HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 735
- Sequence: atggaggtgacgggggtgtcggcacccacggtgaccgttttcatcagcagctccctcaacaccttccgctccgagaagcgatacagccgcagcctcaccatcgctgagttcaagtgtaaactggagttgctggtgggcagccctgcttcctgcatggaactggagctgtatggagt
- Show more
|
Description: A cloning plasmid for the TBCB gene. |
Mouse TBCB shRNA Plasmid |
20-abx975596 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human TBCB shRNA Plasmid |
20-abx950829 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
TBCB protein (His tag) |
80R-2321 |
Fitzgerald |
100 ug |
EUR 322 |
Description: Purified recombinant Human TBCB Protein (His tag) |
TBCB Recombinant Protein (Human) |
RP031033 |
ABM |
100 ug |
Ask for price |
TBCB Recombinant Protein (Rat) |
RP232457 |
ABM |
100 ug |
Ask for price |
TBCB Recombinant Protein (Mouse) |
RP177578 |
ABM |
100 ug |
Ask for price |
Tubulin Folding Cofactor B (TBCB) Antibody |
20-abx116336 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Tubulin Folding Cofactor B (TBCB) Antibody |
20-abx002740 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Tubulin Folding Cofactor B (TBCB) Antibody |
abx030766-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Tubulin Folding Cofactor B (TBCB) Antibody |
abx030766-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Tubulin Folding Cofactor B (TBCB) Antibody |
20-abx317904 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Tubulin Folding Cofactor B (TBCB) Antibody |
abx238517-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Tubulin Folding Cofactor B (TBCB) Antibody (HRP) |
20-abx306301 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Tubulin Folding Cofactor B (TBCB) Antibody (FITC) |
20-abx306302 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Tubulin Folding Cofactor B (TBCB) Antibody (Biotin) |
20-abx306303 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Tbcb ORF Vector (Mouse) (pORF) |
ORF059194 |
ABM |
1.0 ug DNA |
EUR 506 |
TBCB ORF Vector (Human) (pORF) |
ORF010345 |
ABM |
1.0 ug DNA |
EUR 95 |
Tbcb ORF Vector (Rat) (pORF) |
ORF077487 |
ABM |
1.0 ug DNA |
EUR 506 |
Tubulin Folding Cofactor B (TBCB) Protein |
20-abx260902 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
TBCB sgRNA CRISPR Lentivector set (Human) |
K2342201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Tbcb sgRNA CRISPR Lentivector set (Mouse) |
K4579101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Tbcb sgRNA CRISPR Lentivector set (Rat) |
K6648801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Recombinant Tubulin Folding Cofactor B (TBCB) |
4-RPE725Hu01 |
Cloud-Clone |
-
EUR 368.80
-
EUR 202.00
-
EUR 1108.00
-
EUR 436.00
-
EUR 772.00
-
EUR 310.00
-
EUR 2620.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q99426
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 31.0kDa
- Isoelectric Point: 5.1
|
Description: Recombinant Human Tubulin Folding Cofactor B expressed in: E.coli |
Recombinant Tubulin Folding Cofactor B (TBCB) |
4-RPE725Mu01 |
Cloud-Clone |
-
EUR 395.68
-
EUR 209.00
-
EUR 1208.80
-
EUR 469.60
-
EUR 839.20
-
EUR 328.00
-
EUR 2872.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9D1E6
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 31.1kDa
- Isoelectric Point: 5.1
|
Description: Recombinant Mouse Tubulin Folding Cofactor B expressed in: E.coli |
Human Tubulin Folding Cofactor B (TBCB) Protein |
20-abx650900 |
Abbexa |
-
EUR 523.00
-
EUR 244.00
-
EUR 1497.00
-
EUR 606.00
-
EUR 384.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Tubulin Folding Cofactor B (TBCB) Protein |
20-abx650901 |
Abbexa |
-
EUR 565.00
-
EUR 258.00
-
EUR 1636.00
-
EUR 662.00
-
EUR 411.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
TBCB sgRNA CRISPR Lentivector (Human) (Target 1) |
K2342202 |
ABM |
1.0 ug DNA |
EUR 154 |
TBCB sgRNA CRISPR Lentivector (Human) (Target 2) |
K2342203 |
ABM |
1.0 ug DNA |
EUR 154 |
TBCB sgRNA CRISPR Lentivector (Human) (Target 3) |
K2342204 |
ABM |
1.0 ug DNA |
EUR 154 |
Tbcb sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4579102 |
ABM |
1.0 ug DNA |
EUR 154 |
Tbcb sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4579103 |
ABM |
1.0 ug DNA |
EUR 154 |
Tbcb sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4579104 |
ABM |
1.0 ug DNA |
EUR 154 |
Tbcb sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6648802 |
ABM |
1.0 ug DNA |
EUR 154 |
Tbcb sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6648803 |
ABM |
1.0 ug DNA |
EUR 154 |
Tbcb sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6648804 |
ABM |
1.0 ug DNA |
EUR 154 |
TBCB Protein Vector (Human) (pPB-C-His) |
PV041377 |
ABM |
500 ng |
EUR 329 |
TBCB Protein Vector (Human) (pPB-N-His) |
PV041378 |
ABM |
500 ng |
EUR 329 |
TBCB Protein Vector (Human) (pPM-C-HA) |
PV041379 |
ABM |
500 ng |
EUR 329 |
TBCB Protein Vector (Human) (pPM-C-His) |
PV041380 |
ABM |
500 ng |
EUR 329 |
Recombinant Human TBCB Protein, His, E.coli-1mg |
QP13696-1mg |
EnQuireBio |
1mg |
EUR 2757 |
Recombinant Human TBCB Protein, His, E.coli-25ug |
QP13696-25ug |
EnQuireBio |
25ug |
EUR 201 |
Recombinant Human TBCB Protein, His, E.coli-5ug |
QP13696-5ug |
EnQuireBio |
5ug |
EUR 155 |
TBCB Protein Vector (Rat) (pPB-C-His) |
PV309946 |
ABM |
500 ng |
EUR 603 |
TBCB Protein Vector (Rat) (pPB-N-His) |
PV309947 |
ABM |
500 ng |
EUR 603 |
TBCB Protein Vector (Rat) (pPM-C-HA) |
PV309948 |
ABM |
500 ng |
EUR 603 |
TBCB Protein Vector (Rat) (pPM-C-His) |
PV309949 |
ABM |
500 ng |
EUR 603 |
TBCB Protein Vector (Mouse) (pPB-C-His) |
PV236774 |
ABM |
500 ng |
EUR 603 |
TBCB Protein Vector (Mouse) (pPB-N-His) |
PV236775 |
ABM |
500 ng |
EUR 603 |
TBCB Protein Vector (Mouse) (pPM-C-HA) |
PV236776 |
ABM |
500 ng |
EUR 603 |
TBCB Protein Vector (Mouse) (pPM-C-His) |
PV236777 |
ABM |
500 ng |
EUR 603 |
Tbcb 3'UTR GFP Stable Cell Line |
TU170217 |
ABM |
1.0 ml |
Ask for price |
Tbcb 3'UTR Luciferase Stable Cell Line |
TU120217 |
ABM |
1.0 ml |
Ask for price |
TBCB 3'UTR GFP Stable Cell Line |
TU075226 |
ABM |
1.0 ml |
EUR 1394 |
TBCB 3'UTR Luciferase Stable Cell Line |
TU025226 |
ABM |
1.0 ml |
EUR 1394 |
Tbcb 3'UTR Luciferase Stable Cell Line |
TU221647 |
ABM |
1.0 ml |
Ask for price |
Tbcb 3'UTR GFP Stable Cell Line |
TU271647 |
ABM |
1.0 ml |
Ask for price |
Bovine Tubulin- folding cofactor B, TBCB ELISA KIT |
ELI-18850b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Tubulin- folding cofactor B, Tbcb ELISA KIT |
ELI-52876m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Tubulin- folding cofactor B, TBCB ELISA KIT |
ELI-39704h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Tubulin Folding Cofactor B (TBCB) ELISA Kit |
abx383647-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
TBCB Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV622027 |
ABM |
1.0 ug DNA |
EUR 514 |
TBCB Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV622031 |
ABM |
1.0 ug DNA |
EUR 514 |
TBCB Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV622032 |
ABM |
1.0 ug DNA |
EUR 514 |
TBCB Tubulin Folding Cofactor B Human Recombinant Protein |
PROTQ99426 |
BosterBio |
Regular: 25ug |
EUR 317 |
Description: TBCB Human Recombinant produced in E. coli is a single polypeptide chain containing 268 amino acids (1-244) and having a molecular mass of 29.9 kDa.;TBCB is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
TBCB Rabbit Polyclonal Antibody