TBX15 Rabbit Polyclonal Antibody

TBX15 Polyclonal Antibody
ABP60634-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human TBX15 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TBX15 from Human, Mouse. This TBX15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TBX15 protein

TBX15 Polyclonal Antibody
ABP60634-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TBX15 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TBX15 from Human, Mouse. This TBX15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TBX15 protein

TBX15 Polyclonal Antibody
ABP60634-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TBX15 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TBX15 from Human, Mouse. This TBX15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TBX15 protein

Tbx15 Polyclonal Antibody
A63544 100 µg
EUR 570.55
Description: Ask the seller for details

TBX15 Polyclonal Antibody
A61258 100 µg
EUR 570.55
Description: reagents widely cited

TBX15/18 Polyclonal Antibody
ES3567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TBX15/18 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

TBX15/18 Polyclonal Antibody
ES3567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TBX15/18 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

TBX15/18 Polyclonal Antibody
ABP52568-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human TBX15/18 at AA range: 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of TBX15/18 from Human, Mouse. This TBX15/18 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TBX15/18 at AA range: 130-210

TBX15/18 Polyclonal Antibody
ABP52568-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human TBX15/18 at AA range: 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of TBX15/18 from Human, Mouse. This TBX15/18 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TBX15/18 at AA range: 130-210

TBX15/18 Polyclonal Antibody
ABP52568-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human TBX15/18 at AA range: 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of TBX15/18 from Human, Mouse. This TBX15/18 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TBX15/18 at AA range: 130-210

TBX15 antibody
70R-8761 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TBX15 antibody

TBX15 antibody
20R-1270 100 ug
EUR 377
Description: Rabbit polyclonal TBX15 antibody

TBX15 Antibody
1-CSB-PA839414HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBX15. Recognizes TBX15 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

Tbx15 Antibody
1-CSB-PA023247LA01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Tbx15. Recognizes Tbx15 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA

Tbx15 Polyclonal Antibody, HRP Conjugated
A63545 100 µg
EUR 570.55
Description: The best epigenetics products

Tbx15 Polyclonal Antibody, FITC Conjugated
A63546 100 µg
EUR 570.55
Description: kits suitable for this type of research

Tbx15 Polyclonal Antibody, Biotin Conjugated
A63547 100 µg
EUR 570.55
Description: fast delivery possible

TBX15 Polyclonal Antibody, Biotin Conjugated
A61259 100 µg
EUR 570.55
Description: Ask the seller for details

TBX15 Polyclonal Antibody, FITC Conjugated
A61260 100 µg
EUR 570.55
Description: The best epigenetics products

TBX15 Polyclonal Antibody, HRP Conjugated
A61261 100 µg
EUR 570.55
Description: kits suitable for this type of research

T-box 15 (TBX15) polyclonal antibody
ABP-PAB-11247 100 ug Ask for price
    • Product line: Transcription Factors
    • Brand:

anti- TBX15 antibody
FNab08534 100µg
EUR 585
  • Immunogen: T-box 15
  • Uniprot ID: Q96SF7
  • Gene ID: 6913
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against TBX15

TBX15/18 Antibody
ABD8727 100 ug
EUR 438

TBX18 / TBX15 Antibody
20-abx326152
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

TBX15 / TBX18 Antibody
abx331522-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

TBX15/18 antibody
70R-50670 100 ul
EUR 244
Description: Purified Polyclonal TBX15/18 antibody

TBX15/18 antibody
70R-33773 100 ug
EUR 327
Description: Rabbit polyclonal TBX15/18 antibody

TBX15/18 Antibody
33639-100ul 100ul
EUR 252

TBX15/18 Antibody
33639-50ul 50ul
EUR 187

TBX15/18 Antibody
DF8727 200ul
EUR 304
Description: TBX15/18 Antibody detects endogenous levels of total TBX15/18.

TBX18/TBX15 Antibody
1-CSB-PA004240
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TBX18/TBX15. Recognizes TBX18/TBX15 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

TBX15/TBX18 Antibody
CSB-PA205481-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TBX15/TBX18. Recognizes TBX15/TBX18 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

TBX15/TBX18 Antibody
CSB-PA205481-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TBX15/TBX18. Recognizes TBX15/TBX18 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

Anti-TBX15 antibody
PAab08534 100 ug
EUR 412

Anti-TBX15 antibody
STJ191503 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TBX15

TBX15 siRNA
20-abx936254
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TBX15 siRNA
20-abx936255
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

T-Box Transcription Factor TBX15/18 (TBX15/18) Antibody
20-abx013348
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

TBX15/18 Conjugated Antibody
C33639 100ul
EUR 397

Anti-TBX15/18 Antibody
A06044-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for TBX15/18 Antibody (TBX18) detection.tested for WB in Human, Mouse.

Anti-TBX15/18 Antibody
A08871 100ul
EUR 397
Description: Rabbit Polyclonal TBX15/18 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse.

TBX15 Antibody, HRP conjugated
1-CSB-PA839414HB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBX15. Recognizes TBX15 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TBX15 Antibody, FITC conjugated
1-CSB-PA839414HC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBX15. Recognizes TBX15 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TBX15 Antibody, Biotin conjugated
1-CSB-PA839414HD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBX15. Recognizes TBX15 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Tbx15 Antibody, HRP conjugated
1-CSB-PA023247LB01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Tbx15. Recognizes Tbx15 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Tbx15 Antibody, FITC conjugated
1-CSB-PA023247LC01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Tbx15. Recognizes Tbx15 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Tbx15 Antibody, Biotin conjugated
1-CSB-PA023247LD01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Tbx15. Recognizes Tbx15 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-TBX15/18 antibody
STJ95931 200 µl
EUR 197
Description: Rabbit polyclonal to TBX15/18.

Human T-box transcription factor TBX15 (TBX15)
1-CSB-EP839414HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 70.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human T-box transcription factor TBX15(TBX15) expressed in E.coli

TBX15 Blocking Peptide
33R-10115 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TBX15 antibody, catalog no. 20R-1270

TBX15 Blocking Peptide
33R-8862 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TBX15 antibody, catalog no. 70R-8761

TBX15 cloning plasmid
CSB-CL839414HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1491
  • Sequence: ATGTCTTCCATGGAGGAGATTCAGGTGGAGCTGCAATGTGCTGACCTCTGGAAGCGGTTCCATGATATTGGAACTGAAATGATCATCACCAAAGCAGGCAGGAGGATGTTTCCTGCCATGAGAGTGAAAATCACTGGCCTAGATCCACATCAGCAGTACTACATAGCAATGGACA
  • Show more
Description: A cloning plasmid for the TBX15 gene.

Mouse T- box transcription factor TBX15, Tbx15 ELISA KIT
ELI-13736m 96 Tests
EUR 865

Human T- box transcription factor TBX15, TBX15 ELISA KIT
ELI-41427h 96 Tests
EUR 824

TBX15 ELISA KIT|Human
EF003481 96 Tests
EUR 689

Human TBX15 shRNA Plasmid
20-abx954738
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TBX15/18 Blocking Peptide
DF8727-BP 1mg
EUR 195

Mouse TBX15 shRNA Plasmid
20-abx973005
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TBX15 Recombinant Protein (Human)
RP044029 100 ug Ask for price

TBX15 Recombinant Protein (Rat)
RP232511 100 ug Ask for price

TBX15 Recombinant Protein (Mouse)
RP177650 100 ug Ask for price

T-Box Protein 15 (TBX15) Antibody
abx122856-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

T-Box Protein 15 (TBX15) Antibody
abx030360-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

T-Box Protein 15 (TBX15) Antibody
abx030360-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

T-Box Protein 15 (TBX15) Antibody
20-abx309391
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

T-Box Protein 15 (Tbx15) Antibody
20-abx319107
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

T-Box Protein 15 (TBX15) Antibody
abx238534-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

T-Box Protein 15 (TBX15) Antibody (HRP)
20-abx309392
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

T-Box Protein 15 (TBX15) Antibody (FITC)
20-abx309393
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

T-Box Protein 15 (TBX15) Antibody (Biotin)
20-abx309394
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

T-Box Protein 15 (Tbx15) Antibody (HRP)
20-abx319108
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

T-Box Protein 15 (Tbx15) Antibody (FITC)
20-abx319109
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

T-Box Protein 15 (Tbx15) Antibody (Biotin)
20-abx319110
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TBX15 / 18 Cell ELISA Kit
abx595695-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Tbx15 ORF Vector (Mouse) (pORF)
ORF059218 1.0 ug DNA
EUR 506

Tbx15 ORF Vector (Rat) (pORF)
ORF077505 1.0 ug DNA
EUR 506

TBX15 ORF Vector (Human) (pORF)
ORF014677 1.0 ug DNA
EUR 354

TBX15/18 Colorimetric Cell-Based ELISA
EKC1664 100ul
EUR 572

TBX15 sgRNA CRISPR Lentivector set (Human)
K2344801 3 x 1.0 ug
EUR 339

Tbx15 sgRNA CRISPR Lentivector set (Mouse)
K3902501 3 x 1.0 ug
EUR 339

Tbx15 sgRNA CRISPR Lentivector set (Rat)
K6094901 3 x 1.0 ug
EUR 339

TBX15 sgRNA CRISPR Lentivector (Human) (Target 1)
K2344802 1.0 ug DNA
EUR 154

TBX15 sgRNA CRISPR Lentivector (Human) (Target 2)
K2344803 1.0 ug DNA
EUR 154

TBX15 sgRNA CRISPR Lentivector (Human) (Target 3)
K2344804 1.0 ug DNA
EUR 154

Tbx15 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3902502 1.0 ug DNA
EUR 154

Tbx15 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3902503 1.0 ug DNA
EUR 154

Tbx15 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3902504 1.0 ug DNA
EUR 154

Tbx15 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6094902 1.0 ug DNA
EUR 154

Tbx15 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6094903 1.0 ug DNA
EUR 154

Tbx15 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6094904 1.0 ug DNA
EUR 154

TBX15 Protein Vector (Human) (pPB-C-His)
PV058705 500 ng
EUR 481

TBX15 Protein Vector (Human) (pPB-N-His)
PV058706 500 ng
EUR 481

TBX15 Protein Vector (Human) (pPM-C-HA)
PV058707 500 ng
EUR 481

TBX15 Protein Vector (Human) (pPM-C-His)
PV058708 500 ng
EUR 481

TBX15 Protein Vector (Rat) (pPB-C-His)
PV310018 500 ng
EUR 603

TBX15 Protein Vector (Rat) (pPB-N-His)
PV310019 500 ng
EUR 603

TBX15 Protein Vector (Rat) (pPM-C-HA)
PV310020 500 ng
EUR 603

TBX15 Protein Vector (Rat) (pPM-C-His)
PV310021 500 ng
EUR 603

TBX15 Protein Vector (Mouse) (pPB-C-His)
PV236870 500 ng
EUR 603

TBX15 Protein Vector (Mouse) (pPB-N-His)
PV236871 500 ng
EUR 603

TBX15 Protein Vector (Mouse) (pPM-C-HA)
PV236872 500 ng
EUR 603

TBX15 Protein Vector (Mouse) (pPM-C-His)
PV236873 500 ng
EUR 603

Tbx15 3'UTR GFP Stable Cell Line
TU170237 1.0 ml Ask for price

Tbx15 3'UTR Luciferase Stable Cell Line
TU120237 1.0 ml Ask for price

TBX15 3'UTR GFP Stable Cell Line
TU075254 1.0 ml
EUR 1521

TBX15 3'UTR Luciferase Stable Cell Line
TU025254 1.0 ml
EUR 1521

Tbx15 3'UTR Luciferase Stable Cell Line
TU221666 1.0 ml Ask for price

Tbx15 3'UTR GFP Stable Cell Line
TU271666 1.0 ml Ask for price

Human T-Box protein 15 (TBX15) ELISA Kit
abx383659-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

TBX15/18 Colorimetric Cell-Based ELISA Kit (OKAG01184)
OKAG01184 96 Wells
EUR 596
Description: Description of target: ;Species reactivity: Human, Mouse;Application: ELISA;Assay info: Assay Type: Cell-Based
Subtype: None
Detection Method: Colorimetric 450 nm;Sensitivity:

VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

TBX15 Rabbit Polyclonal Antibody