TBX15 Polyclonal Antibody |
ABP60634-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human TBX15 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of TBX15 from Human, Mouse. This TBX15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TBX15 protein |
TBX15 Polyclonal Antibody |
ABP60634-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human TBX15 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of TBX15 from Human, Mouse. This TBX15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TBX15 protein |
TBX15 Polyclonal Antibody |
ABP60634-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human TBX15 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of TBX15 from Human, Mouse. This TBX15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TBX15 protein |
Tbx15 Polyclonal Antibody |
A63544 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
TBX15 Polyclonal Antibody |
A61258 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
TBX15/18 Polyclonal Antibody |
ES3567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against TBX15/18 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
TBX15/18 Polyclonal Antibody |
ES3567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against TBX15/18 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
TBX15/18 Polyclonal Antibody |
ABP52568-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human TBX15/18 at AA range: 130-210
- Applications tips:
|
Description: A polyclonal antibody for detection of TBX15/18 from Human, Mouse. This TBX15/18 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TBX15/18 at AA range: 130-210 |
TBX15/18 Polyclonal Antibody |
ABP52568-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human TBX15/18 at AA range: 130-210
- Applications tips:
|
Description: A polyclonal antibody for detection of TBX15/18 from Human, Mouse. This TBX15/18 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TBX15/18 at AA range: 130-210 |
TBX15/18 Polyclonal Antibody |
ABP52568-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human TBX15/18 at AA range: 130-210
- Applications tips:
|
Description: A polyclonal antibody for detection of TBX15/18 from Human, Mouse. This TBX15/18 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TBX15/18 at AA range: 130-210 |
TBX15 antibody |
70R-8761 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal TBX15 antibody |
TBX15 antibody |
20R-1270 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal TBX15 antibody |
TBX15 Antibody |
1-CSB-PA839414HA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TBX15. Recognizes TBX15 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000 |
Tbx15 Antibody |
1-CSB-PA023247LA01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Tbx15. Recognizes Tbx15 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA |
Tbx15 Polyclonal Antibody, HRP Conjugated |
A63545 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Tbx15 Polyclonal Antibody, FITC Conjugated |
A63546 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
Tbx15 Polyclonal Antibody, Biotin Conjugated |
A63547 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
TBX15 Polyclonal Antibody, Biotin Conjugated |
A61259 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
TBX15 Polyclonal Antibody, FITC Conjugated |
A61260 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
TBX15 Polyclonal Antibody, HRP Conjugated |
A61261 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
T-box 15 (TBX15) polyclonal antibody |
ABP-PAB-11247 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Transcription Factors
- Brand:
|
anti- TBX15 antibody |
FNab08534 |
FN Test |
100µg |
EUR 585 |
- Immunogen: T-box 15
- Uniprot ID: Q96SF7
- Gene ID: 6913
- Research Area: Metabolism, Developmental biology
|
Description: Antibody raised against TBX15 |
TBX18 / TBX15 Antibody |
20-abx326152 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TBX15 / TBX18 Antibody |
abx331522-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
TBX15/18 antibody |
70R-50670 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal TBX15/18 antibody |
TBX15/18 antibody |
70R-33773 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal TBX15/18 antibody |
TBX15/18 Antibody |
33639-100ul |
SAB |
100ul |
EUR 252 |
TBX15/18 Antibody |
33639-50ul |
SAB |
50ul |
EUR 187 |
TBX15/18 Antibody |
DF8727 |
Affbiotech |
200ul |
EUR 304 |
Description: TBX15/18 Antibody detects endogenous levels of total TBX15/18. |
TBX18/TBX15 Antibody |
1-CSB-PA004240 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against TBX18/TBX15. Recognizes TBX18/TBX15 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000 |
TBX15/TBX18 Antibody |
CSB-PA205481- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against TBX15/TBX18. Recognizes TBX15/TBX18 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500 |
TBX15/TBX18 Antibody |
CSB-PA205481-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against TBX15/TBX18. Recognizes TBX15/TBX18 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500 |
Anti-TBX15 antibody |
STJ191503 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to TBX15 |
TBX15 siRNA |
20-abx936254 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TBX15 siRNA |
20-abx936255 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
T-Box Transcription Factor TBX15/18 (TBX15/18) Antibody |
20-abx013348 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
TBX15/18 Conjugated Antibody |
C33639 |
SAB |
100ul |
EUR 397 |
Anti-TBX15/18 Antibody |
A06044-1 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal Antibody for TBX15/18 Antibody (TBX18) detection.tested for WB in Human, Mouse. |
Anti-TBX15/18 Antibody |
A08871 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal TBX15/18 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse. |
TBX15 Antibody, HRP conjugated |
1-CSB-PA839414HB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TBX15. Recognizes TBX15 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
TBX15 Antibody, FITC conjugated |
1-CSB-PA839414HC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TBX15. Recognizes TBX15 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
TBX15 Antibody, Biotin conjugated |
1-CSB-PA839414HD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TBX15. Recognizes TBX15 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Tbx15 Antibody, HRP conjugated |
1-CSB-PA023247LB01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Tbx15. Recognizes Tbx15 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA |
Tbx15 Antibody, FITC conjugated |
1-CSB-PA023247LC01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Tbx15. Recognizes Tbx15 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA |
Tbx15 Antibody, Biotin conjugated |
1-CSB-PA023247LD01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Tbx15. Recognizes Tbx15 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Anti-TBX15/18 antibody |
STJ95931 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to TBX15/18. |
Human T-box transcription factor TBX15 (TBX15) |
1-CSB-EP839414HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 70.4 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human T-box transcription factor TBX15(TBX15) expressed in E.coli |
TBX15 Blocking Peptide |
33R-10115 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TBX15 antibody, catalog no. 20R-1270 |
TBX15 Blocking Peptide |
33R-8862 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TBX15 antibody, catalog no. 70R-8761 |
TBX15 cloning plasmid |
CSB-CL839414HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1491
- Sequence: ATGTCTTCCATGGAGGAGATTCAGGTGGAGCTGCAATGTGCTGACCTCTGGAAGCGGTTCCATGATATTGGAACTGAAATGATCATCACCAAAGCAGGCAGGAGGATGTTTCCTGCCATGAGAGTGAAAATCACTGGCCTAGATCCACATCAGCAGTACTACATAGCAATGGACA
- Show more
|
Description: A cloning plasmid for the TBX15 gene. |
Mouse T- box transcription factor TBX15, Tbx15 ELISA KIT |
ELI-13736m |
Lifescience Market |
96 Tests |
EUR 865 |
Human T- box transcription factor TBX15, TBX15 ELISA KIT |
ELI-41427h |
Lifescience Market |
96 Tests |
EUR 824 |
Human TBX15 shRNA Plasmid |
20-abx954738 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
TBX15/18 Blocking Peptide |
DF8727-BP |
Affbiotech |
1mg |
EUR 195 |
Mouse TBX15 shRNA Plasmid |
20-abx973005 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
TBX15 Recombinant Protein (Human) |
RP044029 |
ABM |
100 ug |
Ask for price |
TBX15 Recombinant Protein (Rat) |
RP232511 |
ABM |
100 ug |
Ask for price |
TBX15 Recombinant Protein (Mouse) |
RP177650 |
ABM |
100 ug |
Ask for price |
T-Box Protein 15 (TBX15) Antibody |
abx122856-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
T-Box Protein 15 (TBX15) Antibody |
abx030360-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
T-Box Protein 15 (TBX15) Antibody |
abx030360-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
T-Box Protein 15 (TBX15) Antibody |
20-abx309391 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
T-Box Protein 15 (Tbx15) Antibody |
20-abx319107 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
T-Box Protein 15 (TBX15) Antibody |
abx238534-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
T-Box Protein 15 (TBX15) Antibody (HRP) |
20-abx309392 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
T-Box Protein 15 (TBX15) Antibody (FITC) |
20-abx309393 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
T-Box Protein 15 (TBX15) Antibody (Biotin) |
20-abx309394 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
T-Box Protein 15 (Tbx15) Antibody (HRP) |
20-abx319108 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
T-Box Protein 15 (Tbx15) Antibody (FITC) |
20-abx319109 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
T-Box Protein 15 (Tbx15) Antibody (Biotin) |
20-abx319110 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
TBX15 / 18 Cell ELISA Kit |
abx595695-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 1-2 weeks.
|
Tbx15 ORF Vector (Mouse) (pORF) |
ORF059218 |
ABM |
1.0 ug DNA |
EUR 506 |
Tbx15 ORF Vector (Rat) (pORF) |
ORF077505 |
ABM |
1.0 ug DNA |
EUR 506 |
TBX15 ORF Vector (Human) (pORF) |
ORF014677 |
ABM |
1.0 ug DNA |
EUR 354 |
TBX15/18 Colorimetric Cell-Based ELISA |
EKC1664 |
BosterBio |
100ul |
EUR 572 |
TBX15 sgRNA CRISPR Lentivector set (Human) |
K2344801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Tbx15 sgRNA CRISPR Lentivector set (Mouse) |
K3902501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Tbx15 sgRNA CRISPR Lentivector set (Rat) |
K6094901 |
ABM |
3 x 1.0 ug |
EUR 339 |
TBX15 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2344802 |
ABM |
1.0 ug DNA |
EUR 154 |
TBX15 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2344803 |
ABM |
1.0 ug DNA |
EUR 154 |
TBX15 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2344804 |
ABM |
1.0 ug DNA |
EUR 154 |
Tbx15 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3902502 |
ABM |
1.0 ug DNA |
EUR 154 |
Tbx15 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3902503 |
ABM |
1.0 ug DNA |
EUR 154 |
Tbx15 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3902504 |
ABM |
1.0 ug DNA |
EUR 154 |
Tbx15 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6094902 |
ABM |
1.0 ug DNA |
EUR 154 |
Tbx15 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6094903 |
ABM |
1.0 ug DNA |
EUR 154 |
Tbx15 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6094904 |
ABM |
1.0 ug DNA |
EUR 154 |
TBX15 Protein Vector (Human) (pPB-C-His) |
PV058705 |
ABM |
500 ng |
EUR 481 |
TBX15 Protein Vector (Human) (pPB-N-His) |
PV058706 |
ABM |
500 ng |
EUR 481 |
TBX15 Protein Vector (Human) (pPM-C-HA) |
PV058707 |
ABM |
500 ng |
EUR 481 |
TBX15 Protein Vector (Human) (pPM-C-His) |
PV058708 |
ABM |
500 ng |
EUR 481 |
TBX15 Protein Vector (Rat) (pPB-C-His) |
PV310018 |
ABM |
500 ng |
EUR 603 |
TBX15 Protein Vector (Rat) (pPB-N-His) |
PV310019 |
ABM |
500 ng |
EUR 603 |
TBX15 Protein Vector (Rat) (pPM-C-HA) |
PV310020 |
ABM |
500 ng |
EUR 603 |
TBX15 Protein Vector (Rat) (pPM-C-His) |
PV310021 |
ABM |
500 ng |
EUR 603 |
TBX15 Protein Vector (Mouse) (pPB-C-His) |
PV236870 |
ABM |
500 ng |
EUR 603 |
TBX15 Protein Vector (Mouse) (pPB-N-His) |
PV236871 |
ABM |
500 ng |
EUR 603 |
TBX15 Protein Vector (Mouse) (pPM-C-HA) |
PV236872 |
ABM |
500 ng |
EUR 603 |
TBX15 Protein Vector (Mouse) (pPM-C-His) |
PV236873 |
ABM |
500 ng |
EUR 603 |
Tbx15 3'UTR GFP Stable Cell Line |
TU170237 |
ABM |
1.0 ml |
Ask for price |
Tbx15 3'UTR Luciferase Stable Cell Line |
TU120237 |
ABM |
1.0 ml |
Ask for price |
TBX15 3'UTR GFP Stable Cell Line |
TU075254 |
ABM |
1.0 ml |
EUR 1521 |
TBX15 3'UTR Luciferase Stable Cell Line |
TU025254 |
ABM |
1.0 ml |
EUR 1521 |
Tbx15 3'UTR Luciferase Stable Cell Line |
TU221666 |
ABM |
1.0 ml |
Ask for price |
Tbx15 3'UTR GFP Stable Cell Line |
TU271666 |
ABM |
1.0 ml |
Ask for price |
Human T-Box protein 15 (TBX15) ELISA Kit |
abx383659-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
TBX15 Rabbit Polyclonal Antibody