Biocat Net

Amine biocat 3.0

TIPRL Rabbit Polyclonal Antibody

TIPRL Polyclonal Antibody

ABP60695-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TIPRL protein
  • Applications tips:
Description: A polyclonal antibody for detection of TIPRL from Human, Mouse, Rat. This TIPRL antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TIPRL protein

TIPRL Polyclonal Antibody

ABP60695-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TIPRL protein
  • Applications tips:
Description: A polyclonal antibody for detection of TIPRL from Human, Mouse, Rat. This TIPRL antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TIPRL protein

TIPRL Polyclonal Antibody

A61322 100 µg
EUR 570.55
Description: The best epigenetics products

TIPRL Antibody

47284-100ul 100ul
EUR 252

TIPRL antibody

70R-10411 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TIPRL antibody

TIPRL Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIPRL. Recognizes TIPRL from Human. This antibody is Unconjugated. Tested in the following application: ELISA

Polyclonal TIPRL Antibody (C-Term)

AMM08207G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TIPRL (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal TIPRL Antibody (C-term)

AMM08208G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TIPRL (C-term). This antibody is tested and proven to work in the following applications:

TIPRL Polyclonal Antibody, Biotin Conjugated

A61323 100 µg
EUR 570.55
Description: kits suitable for this type of research

TIPRL Polyclonal Antibody, FITC Conjugated

A61324 100 µg
EUR 570.55
Description: fast delivery possible

TIPRL Polyclonal Antibody, HRP Conjugated

A61325 100 µg
EUR 570.55
Description: reagents widely cited

Tiprl/ Rat Tiprl ELISA Kit

ELI-37515r 96 Tests
EUR 886

Polyclonal TIPRL antibody - N-terminal region

AMM08209G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TIPRL - N-terminal region. This antibody is tested and proven to work in the following applications:

TIPRL Conjugated Antibody

C47284 100ul
EUR 397

TIPRL Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TIPRL Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TIPRL Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-TIPRL antibody

STJ72118 100 µg
EUR 359

Anti-TIPRL antibody

STJ191516 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TIPRL


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TIPRL Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIPRL. Recognizes TIPRL from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TIPRL Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIPRL. Recognizes TIPRL from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TIPRL Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIPRL. Recognizes TIPRL from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TIPRL cloning plasmid

CSB-CL023569HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 537
  • Sequence: atgatgatccacggcttccagagcagccaccgggatttctgcttcgggccctggaagctgacggcgtccaagacccacatcatgaagtcggcggatgtggagaaattagccgatgaattacatatgccatctctccctgaaatgatgtttggagacaacgttttaagaatccagca
  • Show more
Description: A cloning plasmid for the TIPRL gene.

TIPRL Blocking Peptide

33R-10346 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TIPRL antibody, catalog no. 70R-10411

TIP41-Like Protein (TIPRL) Antibody

abx030056-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

TIP41-Like Protein (TIPRL) Antibody

abx030056-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

TIP41-Like Protein (TIPRL) Antibody

abx431725-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

TIP41-Like Protein (TIPRL) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse TIPRL shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat TIPRL shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TIPRL shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TIPRL Recombinant Protein (Human)

RP031636 100 ug Ask for price

TIPRL Recombinant Protein (Rat)

RP233192 100 ug Ask for price

TIPRL Recombinant Protein (Mouse)

RP178841 100 ug Ask for price

Tiprl ORF Vector (Mouse) (pORF)

ORF059615 1.0 ug DNA
EUR 506

TIPRL ORF Vector (Human) (pORF)

ORF010546 1.0 ug DNA
EUR 95

Tiprl ORF Vector (Rat) (pORF)

ORF077732 1.0 ug DNA
EUR 506

TIPRL sgRNA CRISPR Lentivector set (Human)

K2376801 3 x 1.0 ug
EUR 339

Tiprl sgRNA CRISPR Lentivector set (Rat)

K6466101 3 x 1.0 ug
EUR 339

Tiprl sgRNA CRISPR Lentivector set (Mouse)

K4920701 3 x 1.0 ug
EUR 339

Human TIP41- like protein, TIPRL ELISA KIT

ELI-52052h 96 Tests
EUR 824

Mouse TIP41- like protein, Tiprl ELISA KIT

ELI-28807m 96 Tests
EUR 865

TIPRL sgRNA CRISPR Lentivector (Human) (Target 1)

K2376802 1.0 ug DNA
EUR 154

TIPRL sgRNA CRISPR Lentivector (Human) (Target 2)

K2376803 1.0 ug DNA
EUR 154

TIPRL sgRNA CRISPR Lentivector (Human) (Target 3)

K2376804 1.0 ug DNA
EUR 154

Tiprl sgRNA CRISPR Lentivector (Rat) (Target 1)

K6466102 1.0 ug DNA
EUR 154

Tiprl sgRNA CRISPR Lentivector (Rat) (Target 2)

K6466103 1.0 ug DNA
EUR 154

Tiprl sgRNA CRISPR Lentivector (Rat) (Target 3)

K6466104 1.0 ug DNA
EUR 154

Tiprl sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4920702 1.0 ug DNA
EUR 154

Tiprl sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4920703 1.0 ug DNA
EUR 154

Tiprl sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4920704 1.0 ug DNA
EUR 154

TIPRL Protein Vector (Human) (pPB-C-His)

PV042181 500 ng
EUR 329

TIPRL Protein Vector (Human) (pPB-N-His)

PV042182 500 ng
EUR 329

TIPRL Protein Vector (Human) (pPM-C-HA)

PV042183 500 ng
EUR 329

TIPRL Protein Vector (Human) (pPM-C-His)

PV042184 500 ng
EUR 329

TIPRL Protein Vector (Rat) (pPB-C-His)

PV310926 500 ng
EUR 603

TIPRL Protein Vector (Rat) (pPB-N-His)

PV310927 500 ng
EUR 603

TIPRL Protein Vector (Rat) (pPM-C-HA)

PV310928 500 ng
EUR 603

TIPRL Protein Vector (Rat) (pPM-C-His)

PV310929 500 ng
EUR 603

TIPRL Protein Vector (Mouse) (pPB-C-His)

PV238458 500 ng
EUR 603

TIPRL Protein Vector (Mouse) (pPB-N-His)

PV238459 500 ng
EUR 603

TIPRL Protein Vector (Mouse) (pPM-C-HA)

PV238460 500 ng
EUR 603

TIPRL Protein Vector (Mouse) (pPM-C-His)

PV238461 500 ng
EUR 603

Tiprl 3'UTR GFP Stable Cell Line

TU170518 1.0 ml Ask for price

TIPRL 3'UTR GFP Stable Cell Line

TU075610 1.0 ml
EUR 1394

Tiprl 3'UTR Luciferase Stable Cell Line

TU120518 1.0 ml Ask for price

TIPRL 3'UTR Luciferase Stable Cell Line

TU025610 1.0 ml
EUR 1394

Tiprl 3'UTR Luciferase Stable Cell Line

TU221912 1.0 ml Ask for price

Tiprl 3'UTR GFP Stable Cell Line

TU271912 1.0 ml Ask for price

ELISA kit for Rat TIP41-like protein (TIPRL)

KTE100115-48T 48T
EUR 332
  • TIPRL is an inhibitory regulator of protein phosphatase-2A (PP2A), PP4 , and PP6. TIP isoform-2 did not interact with PP2A, suggesting that the C terminus of TIP is important for PP2A binding. Incubation of PP2A with TIP, but not TIP isoform-2, resul
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat TIP41-like protein (TIPRL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat TIP41-like protein (TIPRL)

KTE100115-5platesof96wells 5 plates of 96 wells
EUR 2115
  • TIPRL is an inhibitory regulator of protein phosphatase-2A (PP2A), PP4 , and PP6. TIP isoform-2 did not interact with PP2A, suggesting that the C terminus of TIP is important for PP2A binding. Incubation of PP2A with TIP, but not TIP isoform-2, resul
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat TIP41-like protein (TIPRL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat TIP41-like protein (TIPRL)

KTE100115-96T 96T
EUR 539
  • TIPRL is an inhibitory regulator of protein phosphatase-2A (PP2A), PP4 , and PP6. TIP isoform-2 did not interact with PP2A, suggesting that the C terminus of TIP is important for PP2A binding. Incubation of PP2A with TIP, but not TIP isoform-2, resul
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat TIP41-like protein (TIPRL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

TIPRL Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV698593 1.0 ug DNA
EUR 514

TIPRL Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV698597 1.0 ug DNA
EUR 514

TIPRL Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV698598 1.0 ug DNA
EUR 514

ELISA kit for Human TIP41-like protein (TIPRL)

KTE60320-48T 48T
EUR 332
  • TIPRL is an inhibitory regulator of protein phosphatase-2A (PP2A), PP4 , and PP6. TIP isoform-2 did not interact with PP2A, suggesting that the C terminus of TIP is important for PP2A binding. Incubation of PP2A with TIP, but not TIP isoform-2, resul
  • Show more
Description: Quantitative sandwich ELISA for measuring Human TIP41-like protein (TIPRL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human TIP41-like protein (TIPRL)

KTE60320-5platesof96wells 5 plates of 96 wells
EUR 2115
  • TIPRL is an inhibitory regulator of protein phosphatase-2A (PP2A), PP4 , and PP6. TIP isoform-2 did not interact with PP2A, suggesting that the C terminus of TIP is important for PP2A binding. Incubation of PP2A with TIP, but not TIP isoform-2, resul
  • Show more
Description: Quantitative sandwich ELISA for measuring Human TIP41-like protein (TIPRL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human TIP41-like protein (TIPRL)

KTE60320-96T 96T
EUR 539
  • TIPRL is an inhibitory regulator of protein phosphatase-2A (PP2A), PP4 , and PP6. TIP isoform-2 did not interact with PP2A, suggesting that the C terminus of TIP is important for PP2A binding. Incubation of PP2A with TIP, but not TIP isoform-2, resul
  • Show more
Description: Quantitative sandwich ELISA for measuring Human TIP41-like protein (TIPRL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

TIPRL Rabbit Polyclonal Antibody