TIPRL Rabbit Polyclonal Antibody

TIPRL Polyclonal Antibody

ABP60695-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TIPRL protein
  • Applications tips:
Description: A polyclonal antibody for detection of TIPRL from Human, Mouse, Rat. This TIPRL antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TIPRL protein

TIPRL Polyclonal Antibody

ES10358-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TIPRL from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

TIPRL Polyclonal Antibody

ES10358-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TIPRL from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

TIPRL antibody

70R-10411 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TIPRL antibody

TIPRL Antibody

47284-100ul 100ul
EUR 252

TIPRL Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIPRL. Recognizes TIPRL from Human. This antibody is Unconjugated. Tested in the following application: ELISA

Polyclonal TIPRL Antibody (C-Term)

AMM08207G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TIPRL (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal TIPRL Antibody (C-term)

AMM08208G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TIPRL (C-term). This antibody is tested and proven to work in the following applications:

TIPRL Polyclonal Antibody, Biotin Conjugated

A61323 100 µg
EUR 570.55
Description: kits suitable for this type of research

TIPRL Polyclonal Antibody, FITC Conjugated

A61324 100 µg
EUR 570.55
Description: fast delivery possible

TIPRL Polyclonal Antibody, HRP Conjugated

A61325 100 µg
EUR 570.55
Description: reagents widely cited

Tiprl/ Rat Tiprl ELISA Kit

ELI-37515r 96 Tests
EUR 886

Polyclonal TIPRL antibody - N-terminal region

AMM08209G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TIPRL - N-terminal region. This antibody is tested and proven to work in the following applications:

TIPRL Conjugated Antibody

C47284 100ul
EUR 397

TIPRL Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TIPRL Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TIPRL Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-TIPRL antibody

STJ72118 100 µg
EUR 359

Anti-TIPRL antibody

STJ191516 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TIPRL


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TIPRL Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIPRL. Recognizes TIPRL from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TIPRL Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIPRL. Recognizes TIPRL from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TIPRL Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIPRL. Recognizes TIPRL from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TIPRL Blocking Peptide

33R-10346 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TIPRL antibody, catalog no. 70R-10411

TIPRL cloning plasmid

CSB-CL023569HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 537
  • Sequence: atgatgatccacggcttccagagcagccaccgggatttctgcttcgggccctggaagctgacggcgtccaagacccacatcatgaagtcggcggatgtggagaaattagccgatgaattacatatgccatctctccctgaaatgatgtttggagacaacgttttaagaatccagca
  • Show more
Description: A cloning plasmid for the TIPRL gene.

TIP41-Like Protein (TIPRL) Antibody

abx030056-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

TIP41-Like Protein (TIPRL) Antibody

abx030056-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

TIP41-Like Protein (TIPRL) Antibody

abx431725-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

TIP41-Like Protein (TIPRL) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rat TIPRL shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TIPRL shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse TIPRL shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TIPRL Recombinant Protein (Rat)

RP233192 100 ug Ask for price

TIPRL Recombinant Protein (Human)

RP031636 100 ug Ask for price

TIPRL Recombinant Protein (Mouse)

RP178841 100 ug Ask for price

Tiprl ORF Vector (Rat) (pORF)

ORF077732 1.0 ug DNA
EUR 506

TIPRL ORF Vector (Human) (pORF)

ORF010546 1.0 ug DNA
EUR 95

Tiprl ORF Vector (Mouse) (pORF)

ORF059615 1.0 ug DNA
EUR 506

Tiprl sgRNA CRISPR Lentivector set (Mouse)

K4920701 3 x 1.0 ug
EUR 339

Tiprl sgRNA CRISPR Lentivector set (Rat)

K6466101 3 x 1.0 ug
EUR 339

TIPRL sgRNA CRISPR Lentivector set (Human)

K2376801 3 x 1.0 ug
EUR 339

Mouse TIP41- like protein, Tiprl ELISA KIT

ELI-28807m 96 Tests
EUR 865

Human TIP41- like protein, TIPRL ELISA KIT

ELI-52052h 96 Tests
EUR 824

Tiprl sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4920702 1.0 ug DNA
EUR 154

Tiprl sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4920703 1.0 ug DNA
EUR 154

Tiprl sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4920704 1.0 ug DNA
EUR 154

Tiprl sgRNA CRISPR Lentivector (Rat) (Target 1)

K6466102 1.0 ug DNA
EUR 154

Tiprl sgRNA CRISPR Lentivector (Rat) (Target 2)

K6466103 1.0 ug DNA
EUR 154

Tiprl sgRNA CRISPR Lentivector (Rat) (Target 3)

K6466104 1.0 ug DNA
EUR 154

TIPRL sgRNA CRISPR Lentivector (Human) (Target 1)

K2376802 1.0 ug DNA
EUR 154

TIPRL sgRNA CRISPR Lentivector (Human) (Target 2)

K2376803 1.0 ug DNA
EUR 154

TIPRL sgRNA CRISPR Lentivector (Human) (Target 3)

K2376804 1.0 ug DNA
EUR 154

TIPRL Protein Vector (Rat) (pPB-C-His)

PV310926 500 ng
EUR 603

TIPRL Protein Vector (Rat) (pPB-N-His)

PV310927 500 ng
EUR 603

TIPRL Protein Vector (Rat) (pPM-C-HA)

PV310928 500 ng
EUR 603

TIPRL Protein Vector (Rat) (pPM-C-His)

PV310929 500 ng
EUR 603

TIPRL Protein Vector (Human) (pPB-C-His)

PV042181 500 ng
EUR 329

TIPRL Protein Vector (Human) (pPB-N-His)

PV042182 500 ng
EUR 329

TIPRL Protein Vector (Human) (pPM-C-HA)

PV042183 500 ng
EUR 329

TIPRL Protein Vector (Human) (pPM-C-His)

PV042184 500 ng
EUR 329

TIPRL Protein Vector (Mouse) (pPB-C-His)

PV238458 500 ng
EUR 603

TIPRL Protein Vector (Mouse) (pPB-N-His)

PV238459 500 ng
EUR 603

TIPRL Protein Vector (Mouse) (pPM-C-HA)

PV238460 500 ng
EUR 603

TIPRL Protein Vector (Mouse) (pPM-C-His)

PV238461 500 ng
EUR 603

Tiprl 3'UTR Luciferase Stable Cell Line

TU120518 1.0 ml Ask for price

Tiprl 3'UTR GFP Stable Cell Line

TU170518 1.0 ml Ask for price

Tiprl 3'UTR Luciferase Stable Cell Line

TU221912 1.0 ml Ask for price

TIPRL 3'UTR GFP Stable Cell Line

TU075610 1.0 ml
EUR 1394

Tiprl 3'UTR GFP Stable Cell Line

TU271912 1.0 ml Ask for price

TIPRL 3'UTR Luciferase Stable Cell Line

TU025610 1.0 ml
EUR 1394

ELISA kit for Rat TIP41-like protein (TIPRL)

KTE100115-48T 48T
EUR 332
  • TIPRL is an inhibitory regulator of protein phosphatase-2A (PP2A), PP4 , and PP6. TIP isoform-2 did not interact with PP2A, suggesting that the C terminus of TIP is important for PP2A binding. Incubation of PP2A with TIP, but not TIP isoform-2, resul
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat TIP41-like protein (TIPRL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat TIP41-like protein (TIPRL)

KTE100115-5platesof96wells 5 plates of 96 wells
EUR 2115
  • TIPRL is an inhibitory regulator of protein phosphatase-2A (PP2A), PP4 , and PP6. TIP isoform-2 did not interact with PP2A, suggesting that the C terminus of TIP is important for PP2A binding. Incubation of PP2A with TIP, but not TIP isoform-2, resul
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat TIP41-like protein (TIPRL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat TIP41-like protein (TIPRL)

KTE100115-96T 96T
EUR 539
  • TIPRL is an inhibitory regulator of protein phosphatase-2A (PP2A), PP4 , and PP6. TIP isoform-2 did not interact with PP2A, suggesting that the C terminus of TIP is important for PP2A binding. Incubation of PP2A with TIP, but not TIP isoform-2, resul
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat TIP41-like protein (TIPRL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

TIPRL Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV698593 1.0 ug DNA
EUR 514

TIPRL Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV698597 1.0 ug DNA
EUR 514

TIPRL Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV698598 1.0 ug DNA
EUR 514

ELISA kit for Human TIP41-like protein (TIPRL)

KTE60320-48T 48T
EUR 332
  • TIPRL is an inhibitory regulator of protein phosphatase-2A (PP2A), PP4 , and PP6. TIP isoform-2 did not interact with PP2A, suggesting that the C terminus of TIP is important for PP2A binding. Incubation of PP2A with TIP, but not TIP isoform-2, resul
  • Show more
Description: Quantitative sandwich ELISA for measuring Human TIP41-like protein (TIPRL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human TIP41-like protein (TIPRL)

KTE60320-5platesof96wells 5 plates of 96 wells
EUR 2115
  • TIPRL is an inhibitory regulator of protein phosphatase-2A (PP2A), PP4 , and PP6. TIP isoform-2 did not interact with PP2A, suggesting that the C terminus of TIP is important for PP2A binding. Incubation of PP2A with TIP, but not TIP isoform-2, resul
  • Show more
Description: Quantitative sandwich ELISA for measuring Human TIP41-like protein (TIPRL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human TIP41-like protein (TIPRL)

KTE60320-96T 96T
EUR 539
  • TIPRL is an inhibitory regulator of protein phosphatase-2A (PP2A), PP4 , and PP6. TIP isoform-2 did not interact with PP2A, suggesting that the C terminus of TIP is important for PP2A binding. Incubation of PP2A with TIP, but not TIP isoform-2, resul
  • Show more
Description: Quantitative sandwich ELISA for measuring Human TIP41-like protein (TIPRL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

TIPRL Rabbit Polyclonal Antibody