TIPRL Polyclonal Antibody |
ABP60695-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human TIPRL protein
- Applications tips:
|
Description: A polyclonal antibody for detection of TIPRL from Human, Mouse, Rat. This TIPRL antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TIPRL protein |
TIPRL Polyclonal Antibody |
ES10358-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against TIPRL from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
TIPRL Polyclonal Antibody |
ES10358-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against TIPRL from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
TIPRL antibody |
70R-10411 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal TIPRL antibody |
TIPRL Antibody |
47284-100ul |
SAB |
100ul |
EUR 252 |
TIPRL Antibody |
1-CSB-PA023569LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TIPRL. Recognizes TIPRL from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
Polyclonal TIPRL Antibody (C-Term) |
AMM08207G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TIPRL (C-Term). This antibody is tested and proven to work in the following applications: |
Polyclonal TIPRL Antibody (C-term) |
AMM08208G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TIPRL (C-term). This antibody is tested and proven to work in the following applications: |
TIPRL Polyclonal Antibody, Biotin Conjugated |
A61323 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
TIPRL Polyclonal Antibody, FITC Conjugated |
A61324 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
TIPRL Polyclonal Antibody, HRP Conjugated |
A61325 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
Polyclonal TIPRL antibody - N-terminal region |
AMM08209G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TIPRL - N-terminal region. This antibody is tested and proven to work in the following applications: |
TIPRL Conjugated Antibody |
C47284 |
SAB |
100ul |
EUR 397 |
TIPRL Antibody (HRP) |
20-abx305547 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
TIPRL Antibody (FITC) |
20-abx305548 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
TIPRL Antibody (Biotin) |
20-abx305549 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-TIPRL antibody |
STJ191516 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to TIPRL |
TIPRL siRNA |
20-abx905589 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TIPRL siRNA |
20-abx936836 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TIPRL siRNA |
20-abx936837 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TIPRL Antibody, HRP conjugated |
1-CSB-PA023569LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TIPRL. Recognizes TIPRL from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
TIPRL Antibody, FITC conjugated |
1-CSB-PA023569LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TIPRL. Recognizes TIPRL from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
TIPRL Antibody, Biotin conjugated |
1-CSB-PA023569LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TIPRL. Recognizes TIPRL from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
TIPRL Blocking Peptide |
33R-10346 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TIPRL antibody, catalog no. 70R-10411 |
TIPRL cloning plasmid |
CSB-CL023569HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 537
- Sequence: atgatgatccacggcttccagagcagccaccgggatttctgcttcgggccctggaagctgacggcgtccaagacccacatcatgaagtcggcggatgtggagaaattagccgatgaattacatatgccatctctccctgaaatgatgtttggagacaacgttttaagaatccagca
- Show more
|
Description: A cloning plasmid for the TIPRL gene. |
TIP41-Like Protein (TIPRL) Antibody |
abx030056-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
TIP41-Like Protein (TIPRL) Antibody |
abx030056-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
TIP41-Like Protein (TIPRL) Antibody |
abx431725-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
TIP41-Like Protein (TIPRL) Antibody |
20-abx305546 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Rat TIPRL shRNA Plasmid |
20-abx990114 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human TIPRL shRNA Plasmid |
20-abx966825 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse TIPRL shRNA Plasmid |
20-abx981502 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
TIPRL Recombinant Protein (Rat) |
RP233192 |
ABM |
100 ug |
Ask for price |
TIPRL Recombinant Protein (Human) |
RP031636 |
ABM |
100 ug |
Ask for price |
TIPRL Recombinant Protein (Mouse) |
RP178841 |
ABM |
100 ug |
Ask for price |
Tiprl ORF Vector (Rat) (pORF) |
ORF077732 |
ABM |
1.0 ug DNA |
EUR 506 |
TIPRL ORF Vector (Human) (pORF) |
ORF010546 |
ABM |
1.0 ug DNA |
EUR 95 |
Tiprl ORF Vector (Mouse) (pORF) |
ORF059615 |
ABM |
1.0 ug DNA |
EUR 506 |
Tiprl sgRNA CRISPR Lentivector set (Mouse) |
K4920701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Tiprl sgRNA CRISPR Lentivector set (Rat) |
K6466101 |
ABM |
3 x 1.0 ug |
EUR 339 |
TIPRL sgRNA CRISPR Lentivector set (Human) |
K2376801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Tiprl sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4920702 |
ABM |
1.0 ug DNA |
EUR 154 |
Tiprl sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4920703 |
ABM |
1.0 ug DNA |
EUR 154 |
Tiprl sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4920704 |
ABM |
1.0 ug DNA |
EUR 154 |
Tiprl sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6466102 |
ABM |
1.0 ug DNA |
EUR 154 |
Tiprl sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6466103 |
ABM |
1.0 ug DNA |
EUR 154 |
Tiprl sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6466104 |
ABM |
1.0 ug DNA |
EUR 154 |
TIPRL sgRNA CRISPR Lentivector (Human) (Target 1) |
K2376802 |
ABM |
1.0 ug DNA |
EUR 154 |
TIPRL sgRNA CRISPR Lentivector (Human) (Target 2) |
K2376803 |
ABM |
1.0 ug DNA |
EUR 154 |
TIPRL sgRNA CRISPR Lentivector (Human) (Target 3) |
K2376804 |
ABM |
1.0 ug DNA |
EUR 154 |
TIPRL Protein Vector (Rat) (pPB-C-His) |
PV310926 |
ABM |
500 ng |
EUR 603 |
TIPRL Protein Vector (Rat) (pPB-N-His) |
PV310927 |
ABM |
500 ng |
EUR 603 |
TIPRL Protein Vector (Rat) (pPM-C-HA) |
PV310928 |
ABM |
500 ng |
EUR 603 |
TIPRL Protein Vector (Rat) (pPM-C-His) |
PV310929 |
ABM |
500 ng |
EUR 603 |
TIPRL Protein Vector (Human) (pPB-C-His) |
PV042181 |
ABM |
500 ng |
EUR 329 |
TIPRL Protein Vector (Human) (pPB-N-His) |
PV042182 |
ABM |
500 ng |
EUR 329 |
TIPRL Protein Vector (Human) (pPM-C-HA) |
PV042183 |
ABM |
500 ng |
EUR 329 |
TIPRL Protein Vector (Human) (pPM-C-His) |
PV042184 |
ABM |
500 ng |
EUR 329 |
TIPRL Protein Vector (Mouse) (pPB-C-His) |
PV238458 |
ABM |
500 ng |
EUR 603 |
TIPRL Protein Vector (Mouse) (pPB-N-His) |
PV238459 |
ABM |
500 ng |
EUR 603 |
TIPRL Protein Vector (Mouse) (pPM-C-HA) |
PV238460 |
ABM |
500 ng |
EUR 603 |
TIPRL Protein Vector (Mouse) (pPM-C-His) |
PV238461 |
ABM |
500 ng |
EUR 603 |
Tiprl 3'UTR Luciferase Stable Cell Line |
TU120518 |
ABM |
1.0 ml |
Ask for price |
Tiprl 3'UTR GFP Stable Cell Line |
TU170518 |
ABM |
1.0 ml |
Ask for price |
Tiprl 3'UTR Luciferase Stable Cell Line |
TU221912 |
ABM |
1.0 ml |
Ask for price |
TIPRL 3'UTR GFP Stable Cell Line |
TU075610 |
ABM |
1.0 ml |
EUR 1394 |
Tiprl 3'UTR GFP Stable Cell Line |
TU271912 |
ABM |
1.0 ml |
Ask for price |
TIPRL 3'UTR Luciferase Stable Cell Line |
TU025610 |
ABM |
1.0 ml |
EUR 1394 |
ELISA kit for Rat TIP41-like protein (TIPRL) |
KTE100115-48T |
Abbkine |
48T |
EUR 332 |
- TIPRL is an inhibitory regulator of protein phosphatase-2A (PP2A), PP4 , and PP6. TIP isoform-2 did not interact with PP2A, suggesting that the C terminus of TIP is important for PP2A binding. Incubation of PP2A with TIP, but not TIP isoform-2, resul
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat TIP41-like protein (TIPRL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat TIP41-like protein (TIPRL) |
KTE100115-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- TIPRL is an inhibitory regulator of protein phosphatase-2A (PP2A), PP4 , and PP6. TIP isoform-2 did not interact with PP2A, suggesting that the C terminus of TIP is important for PP2A binding. Incubation of PP2A with TIP, but not TIP isoform-2, resul
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat TIP41-like protein (TIPRL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat TIP41-like protein (TIPRL) |
KTE100115-96T |
Abbkine |
96T |
EUR 539 |
- TIPRL is an inhibitory regulator of protein phosphatase-2A (PP2A), PP4 , and PP6. TIP isoform-2 did not interact with PP2A, suggesting that the C terminus of TIP is important for PP2A binding. Incubation of PP2A with TIP, but not TIP isoform-2, resul
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat TIP41-like protein (TIPRL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
TIPRL Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV698593 |
ABM |
1.0 ug DNA |
EUR 514 |
TIPRL Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV698597 |
ABM |
1.0 ug DNA |
EUR 514 |
TIPRL Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV698598 |
ABM |
1.0 ug DNA |
EUR 514 |
ELISA kit for Human TIP41-like protein (TIPRL) |
KTE60320-48T |
Abbkine |
48T |
EUR 332 |
- TIPRL is an inhibitory regulator of protein phosphatase-2A (PP2A), PP4 , and PP6. TIP isoform-2 did not interact with PP2A, suggesting that the C terminus of TIP is important for PP2A binding. Incubation of PP2A with TIP, but not TIP isoform-2, resul
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human TIP41-like protein (TIPRL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human TIP41-like protein (TIPRL) |
KTE60320-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- TIPRL is an inhibitory regulator of protein phosphatase-2A (PP2A), PP4 , and PP6. TIP isoform-2 did not interact with PP2A, suggesting that the C terminus of TIP is important for PP2A binding. Incubation of PP2A with TIP, but not TIP isoform-2, resul
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human TIP41-like protein (TIPRL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human TIP41-like protein (TIPRL) |
KTE60320-96T |
Abbkine |
96T |
EUR 539 |
- TIPRL is an inhibitory regulator of protein phosphatase-2A (PP2A), PP4 , and PP6. TIP isoform-2 did not interact with PP2A, suggesting that the C terminus of TIP is important for PP2A binding. Incubation of PP2A with TIP, but not TIP isoform-2, resul
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human TIP41-like protein (TIPRL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
TIPRL Rabbit Polyclonal Antibody