 TIPRL Polyclonal Antibody |
|
ABP60695-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human TIPRL protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of TIPRL from Human, Mouse, Rat. This TIPRL antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TIPRL protein |
TIPRL Polyclonal Antibody |
|
ABP60695-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human TIPRL protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of TIPRL from Human, Mouse, Rat. This TIPRL antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TIPRL protein |
TIPRL Polyclonal Antibody |
|
A61322 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 TIPRL Antibody |
|
47284-100ul |
SAB |
100ul |
EUR 252 |
 TIPRL antibody |
|
70R-10411 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Affinity purified rabbit polyclonal TIPRL antibody |
TIPRL Antibody |
|
1-CSB-PA023569LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against TIPRL. Recognizes TIPRL from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
) Polyclonal TIPRL Antibody (C-Term) |
|
AMM08207G |
Leading Biology |
0.1 mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TIPRL (C-Term). This antibody is tested and proven to work in the following applications: |
) Polyclonal TIPRL Antibody (C-term) |
|
AMM08208G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TIPRL (C-term). This antibody is tested and proven to work in the following applications: |
 TIPRL Polyclonal Antibody, Biotin Conjugated |
|
A61323 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: kits suitable for this type of research |
 TIPRL Polyclonal Antibody, FITC Conjugated |
|
A61324 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: fast delivery possible |
 TIPRL Polyclonal Antibody, HRP Conjugated |
|
A61325 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: reagents widely cited |
 Polyclonal TIPRL antibody - N-terminal region |
|
AMM08209G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TIPRL - N-terminal region. This antibody is tested and proven to work in the following applications: |
 TIPRL Conjugated Antibody |
|
C47284 |
SAB |
100ul |
EUR 397 |
) TIPRL Antibody (HRP) |
|
20-abx305547 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) TIPRL Antibody (FITC) |
|
20-abx305548 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) TIPRL Antibody (Biotin) |
|
20-abx305549 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Anti-TIPRL antibody |
|
STJ191516 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to TIPRL |
 TIPRL siRNA |
|
20-abx905589 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TIPRL siRNA |
|
20-abx936836 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TIPRL siRNA |
|
20-abx936837 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 TIPRL Antibody, HRP conjugated |
|
1-CSB-PA023569LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against TIPRL. Recognizes TIPRL from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 TIPRL Antibody, FITC conjugated |
|
1-CSB-PA023569LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against TIPRL. Recognizes TIPRL from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 TIPRL Antibody, Biotin conjugated |
|
1-CSB-PA023569LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against TIPRL. Recognizes TIPRL from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 TIPRL cloning plasmid |
|
CSB-CL023569HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 537
- Sequence: atgatgatccacggcttccagagcagccaccgggatttctgcttcgggccctggaagctgacggcgtccaagacccacatcatgaagtcggcggatgtggagaaattagccgatgaattacatatgccatctctccctgaaatgatgtttggagacaacgttttaagaatccagca
- Show more
|
|
Description: A cloning plasmid for the TIPRL gene. |
 TIPRL Blocking Peptide |
|
33R-10346 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TIPRL antibody, catalog no. 70R-10411 |
 Antibody) TIP41-Like Protein (TIPRL) Antibody |
|
abx030056-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
TIP41-Like Protein (TIPRL) Antibody |
|
abx030056-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
TIP41-Like Protein (TIPRL) Antibody |
|
abx431725-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
TIP41-Like Protein (TIPRL) Antibody |
|
20-abx305546 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Mouse TIPRL shRNA Plasmid |
|
20-abx981502 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Rat TIPRL shRNA Plasmid |
|
20-abx990114 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human TIPRL shRNA Plasmid |
|
20-abx966825 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) TIPRL Recombinant Protein (Human) |
|
RP031636 |
ABM |
100 ug |
Ask for price |
) TIPRL Recombinant Protein (Rat) |
|
RP233192 |
ABM |
100 ug |
Ask for price |
) TIPRL Recombinant Protein (Mouse) |
|
RP178841 |
ABM |
100 ug |
Ask for price |
 (pORF)) Tiprl ORF Vector (Mouse) (pORF) |
|
ORF059615 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) TIPRL ORF Vector (Human) (pORF) |
|
ORF010546 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Tiprl ORF Vector (Rat) (pORF) |
|
ORF077732 |
ABM |
1.0 ug DNA |
EUR 506 |
) TIPRL sgRNA CRISPR Lentivector set (Human) |
|
K2376801 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Tiprl sgRNA CRISPR Lentivector set (Rat) |
|
K6466101 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Tiprl sgRNA CRISPR Lentivector set (Mouse) |
|
K4920701 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) TIPRL sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2376802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) TIPRL sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2376803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) TIPRL sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2376804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Tiprl sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6466102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Tiprl sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6466103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Tiprl sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6466104 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Tiprl sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4920702 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Tiprl sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4920703 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Tiprl sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4920704 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) TIPRL Protein Vector (Human) (pPB-C-His) |
|
PV042181 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) TIPRL Protein Vector (Human) (pPB-N-His) |
|
PV042182 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) TIPRL Protein Vector (Human) (pPM-C-HA) |
|
PV042183 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) TIPRL Protein Vector (Human) (pPM-C-His) |
|
PV042184 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) TIPRL Protein Vector (Rat) (pPB-C-His) |
|
PV310926 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) TIPRL Protein Vector (Rat) (pPB-N-His) |
|
PV310927 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) TIPRL Protein Vector (Rat) (pPM-C-HA) |
|
PV310928 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) TIPRL Protein Vector (Rat) (pPM-C-His) |
|
PV310929 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) TIPRL Protein Vector (Mouse) (pPB-C-His) |
|
PV238458 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) TIPRL Protein Vector (Mouse) (pPB-N-His) |
|
PV238459 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) TIPRL Protein Vector (Mouse) (pPM-C-HA) |
|
PV238460 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) TIPRL Protein Vector (Mouse) (pPM-C-His) |
|
PV238461 |
ABM |
500 ng |
EUR 603 |
 Tiprl 3'UTR GFP Stable Cell Line |
|
TU170518 |
ABM |
1.0 ml |
Ask for price |
 TIPRL 3'UTR GFP Stable Cell Line |
|
TU075610 |
ABM |
1.0 ml |
EUR 1394 |
 Tiprl 3'UTR Luciferase Stable Cell Line |
|
TU120518 |
ABM |
1.0 ml |
Ask for price |
 TIPRL 3'UTR Luciferase Stable Cell Line |
|
TU025610 |
ABM |
1.0 ml |
EUR 1394 |
Tiprl 3'UTR Luciferase Stable Cell Line |
|
TU221912 |
ABM |
1.0 ml |
Ask for price |
Tiprl 3'UTR GFP Stable Cell Line |
|
TU271912 |
ABM |
1.0 ml |
Ask for price |
) ELISA kit for Rat TIP41-like protein (TIPRL) |
|
KTE100115-48T |
Abbkine |
48T |
EUR 332 |
- TIPRL is an inhibitory regulator of protein phosphatase-2A (PP2A), PP4 , and PP6. TIP isoform-2 did not interact with PP2A, suggesting that the C terminus of TIP is important for PP2A binding. Incubation of PP2A with TIP, but not TIP isoform-2, resul
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Rat TIP41-like protein (TIPRL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat TIP41-like protein (TIPRL) |
|
KTE100115-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- TIPRL is an inhibitory regulator of protein phosphatase-2A (PP2A), PP4 , and PP6. TIP isoform-2 did not interact with PP2A, suggesting that the C terminus of TIP is important for PP2A binding. Incubation of PP2A with TIP, but not TIP isoform-2, resul
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Rat TIP41-like protein (TIPRL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat TIP41-like protein (TIPRL) |
|
KTE100115-96T |
Abbkine |
96T |
EUR 539 |
- TIPRL is an inhibitory regulator of protein phosphatase-2A (PP2A), PP4 , and PP6. TIP isoform-2 did not interact with PP2A, suggesting that the C terminus of TIP is important for PP2A binding. Incubation of PP2A with TIP, but not TIP isoform-2, resul
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Rat TIP41-like protein (TIPRL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
 (CMV) (pLenti-GIII-CMV)) TIPRL Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV698593 |
ABM |
1.0 ug DNA |
EUR 514 |
 (UbC) (pLenti-GIII-UbC)) TIPRL Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV698597 |
ABM |
1.0 ug DNA |
EUR 514 |
 (EF1a) (pLenti-GIII-EF1a)) TIPRL Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV698598 |
ABM |
1.0 ug DNA |
EUR 514 |
) ELISA kit for Human TIP41-like protein (TIPRL) |
|
KTE60320-48T |
Abbkine |
48T |
EUR 332 |
- TIPRL is an inhibitory regulator of protein phosphatase-2A (PP2A), PP4 , and PP6. TIP isoform-2 did not interact with PP2A, suggesting that the C terminus of TIP is important for PP2A binding. Incubation of PP2A with TIP, but not TIP isoform-2, resul
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human TIP41-like protein (TIPRL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human TIP41-like protein (TIPRL) |
|
KTE60320-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- TIPRL is an inhibitory regulator of protein phosphatase-2A (PP2A), PP4 , and PP6. TIP isoform-2 did not interact with PP2A, suggesting that the C terminus of TIP is important for PP2A binding. Incubation of PP2A with TIP, but not TIP isoform-2, resul
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human TIP41-like protein (TIPRL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human TIP41-like protein (TIPRL) |
|
KTE60320-96T |
Abbkine |
96T |
EUR 539 |
- TIPRL is an inhibitory regulator of protein phosphatase-2A (PP2A), PP4 , and PP6. TIP isoform-2 did not interact with PP2A, suggesting that the C terminus of TIP is important for PP2A binding. Incubation of PP2A with TIP, but not TIP isoform-2, resul
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human TIP41-like protein (TIPRL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG14L Rabbit Polyclonal Antibody |
|
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
|
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NBR1 Rabbit Polyclonal Antibody |
|
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
TIPRL Rabbit Polyclonal Antibody
