TNNC2 Polyclonal Antibody |
ES10398-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against TNNC2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
TNNC2 Polyclonal Antibody |
ES10398-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against TNNC2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
TNNC2 Rabbit pAb |
A7740-100ul |
Abclonal |
100 ul |
EUR 308 |
TNNC2 Rabbit pAb |
A7740-200ul |
Abclonal |
200 ul |
EUR 459 |
TNNC2 Rabbit pAb |
A7740-20ul |
Abclonal |
20 ul |
EUR 183 |
TNNC2 Rabbit pAb |
A7740-50ul |
Abclonal |
50 ul |
EUR 223 |
Human Troponin C Type 2, Fast (TNNC2) ELISA Kit |
DLR-TNNC2-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Troponin C Type 2, Fast (TNNC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Troponin C Type 2, Fast (TNNC2) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Troponin C Type 2, Fast (TNNC2) ELISA Kit |
DLR-TNNC2-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Troponin C Type 2, Fast (TNNC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Troponin C Type 2, Fast (TNNC2) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Troponin C Type 2, Fast (TNNC2) ELISA Kit |
RDR-TNNC2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Troponin C Type 2, Fast (TNNC2) ELISA Kit |
RDR-TNNC2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Troponin C Type 2, Fast (TNNC2) ELISA Kit |
RD-TNNC2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Troponin C Type 2, Fast (TNNC2) ELISA Kit |
RD-TNNC2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
TNNC2 Antibody |
47442-100ul |
SAB |
100ul |
EUR 252 |
TNNC2 Antibody |
1-CSB-PA024010ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against TNNC2. Recognizes TNNC2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000 |
TNNC2 Antibody |
1-CSB-PA024010ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against TNNC2. Recognizes TNNC2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
Rabbit TNNC2 ELISA Kit |
ERTT0256 |
Abclonal |
96Tests |
EUR 521 |
Polyclonal TNNC2 Antibody(C-term) |
AMM08263G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNNC2 (C-term). This antibody is tested and proven to work in the following applications: |
TNNC2 Conjugated Antibody |
C47442 |
SAB |
100ul |
EUR 397 |
anti- TNNC2 antibody |
FNab08836 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: troponin C type 2 (fast)
- Uniprot ID: P02585
- Gene ID: 7125
- Research Area: Neuroscience, Signal Transduction, Developmental biology
|
Description: Antibody raised against TNNC2 |
Anti-TNNC2 antibody |
STJ110051 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Troponin (Tn), a key protein complex in the regulation of striated muscle contraction, is composed of 3 subunits. The Tn-I subunit inhibits actomyosin ATPase, the Tn-T subunit binds tropomyosin and Tn-C, while the Tn-C subunit binds calcium and overcomes the inhibitory action of the troponin complex on actin filaments. The protein encoded by this gene is the Tn-C subunit. |
Anti-TNNC2 antibody |
STJ191556 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to TNNC2 |
TNNC2 siRNA |
20-abx937666 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TNNC2 siRNA |
20-abx937667 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-TNNC2 |
YF-PA24866 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to TNNC2 |
TNNC2 cloning plasmid |
CSB-CL024010HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 483
- Sequence: atgacggaccagcaggctgaggccaggtcctacctcagcgaagagatgatcgctgagttcaaggctgcctttgacatgtttgatgctgatggtggtggggacatcagcgtcaaggagttgggcacggtgatgaggatgctgggccagacacccaccaaggaggagctggacgccat
- Show more
|
Description: A cloning plasmid for the TNNC2 gene. |
Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human) |
4-PAD228Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2) |
Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human) |
4-PAD228Hu02 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2) |
Rabbit Troponin C, Skeletal Muscle (TNNC2) ELISA Kit |
abx362622-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Troponin C, skeletal muscle, TNNC2 ELISA KIT |
ELI-39995Ra |
Lifescience Market |
96 Tests |
EUR 928 |
Troponin C Type 2 (TNNC2) Antibody |
20-abx006037 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Troponin C Type 2 (TNNC2) Antibody |
20-abx142271 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Troponin C Type 2 (TNNC2) Antibody |
abx031096-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Troponin C Type 2 (TNNC2) Antibody |
abx031096-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Troponin C Type 2 (TNNC2) Antibody |
abx238836-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Troponin C Type 2 (TNNC2) Antibody |
20-abx322212 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Troponin C Type 2 (TNNC2) Antibody |
20-abx322296 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human TNNC2 ELISA Kit |
EHT0256 |
Abclonal |
96Tests |
EUR 521 |
Bovine TNNC2 ELISA Kit |
EBT0256 |
Abclonal |
96Tests |
EUR 521 |
Anserini TNNC2 ELISA Kit |
EAT0256 |
Abclonal |
96Tests |
EUR 521 |
Chicken TNNC2 ELISA Kit |
ECKT0256 |
Abclonal |
96Tests |
EUR 521 |
Canine TNNC2 ELISA Kit |
ECT0256 |
Abclonal |
96Tests |
EUR 521 |
Goat TNNC2 ELISA Kit |
EGTT0256 |
Abclonal |
96Tests |
EUR 521 |
Mouse TNNC2 shRNA Plasmid |
20-abx973148 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human TNNC2 shRNA Plasmid |
20-abx954886 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Sheep TNNC2 ELISA Kit |
EST0256 |
Abclonal |
96Tests |
EUR 521 |
Porcine TNNC2 ELISA Kit |
EPT0256 |
Abclonal |
96Tests |
EUR 521 |
Rat TNNC2 ELISA Kit |
ERT0256 |
Abclonal |
96Tests |
EUR 521 |
Monkey TNNC2 ELISA Kit |
EMKT0256 |
Abclonal |
96Tests |
EUR 521 |
Mouse TNNC2 ELISA Kit |
EMT0256 |
Abclonal |
96Tests |
EUR 521 |
TNNC2 Recombinant Protein (Rat) |
RP234143 |
ABM |
100 ug |
Ask for price |
TNNC2 Recombinant Protein (Human) |
RP032488 |
ABM |
100 ug |
Ask for price |
TNNC2 Recombinant Protein (Mouse) |
RP180359 |
ABM |
100 ug |
Ask for price |
Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), APC |
4-PAD228Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with APC. |
Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), Biotinylated |
4-PAD228Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with Biotin. |
Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), Cy3 |
4-PAD228Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with Cy3. |
Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), FITC |
4-PAD228Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with FITC. |
Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), HRP |
4-PAD228Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with HRP. |
Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), PE |
4-PAD228Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with PE. |
Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), APC |
4-PAD228Hu02-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with APC. |
Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), Biotinylated |
4-PAD228Hu02-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with Biotin. |
Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), Cy3 |
4-PAD228Hu02-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with Cy3. |
Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), FITC |
4-PAD228Hu02-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with FITC. |
Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), HRP |
4-PAD228Hu02-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with HRP. |
Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), PE |
4-PAD228Hu02-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with PE. |
ELISA kit for Rabbit Troponin C, skeletal muscle (TNNC2) |
KTE90012-48T |
Abbkine |
48T |
EUR 354 |
- The troponin C protein is the calcium-binding subunit of the troponin complex. It occurs in 2 distinct isoforms: fast skeletal troponin C, which is expressed exclusively in fast-twitch skeletal muscle, and slow/cardiac troponin C, which is expressed
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rabbit Troponin C, skeletal muscle (TNNC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rabbit Troponin C, skeletal muscle (TNNC2) |
KTE90012-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- The troponin C protein is the calcium-binding subunit of the troponin complex. It occurs in 2 distinct isoforms: fast skeletal troponin C, which is expressed exclusively in fast-twitch skeletal muscle, and slow/cardiac troponin C, which is expressed
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rabbit Troponin C, skeletal muscle (TNNC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rabbit Troponin C, skeletal muscle (TNNC2) |
KTE90012-96T |
Abbkine |
96T |
EUR 572 |
- The troponin C protein is the calcium-binding subunit of the troponin complex. It occurs in 2 distinct isoforms: fast skeletal troponin C, which is expressed exclusively in fast-twitch skeletal muscle, and slow/cardiac troponin C, which is expressed
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rabbit Troponin C, skeletal muscle (TNNC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), APC-Cy7 |
4-PAD228Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with APC-Cy7. |
Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), APC-Cy7 |
4-PAD228Hu02-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with APC-Cy7. |
Troponin C Type 2, Fast (TNNC2) Antibody |
20-abx102494 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Troponin C Type 2, Fast (TNNC2) Antibody |
20-abx128479 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Guinea Pig TNNC2 ELISA Kit |
EGT0256 |
Abclonal |
96Tests |
EUR 521 |
Tnnc2 ORF Vector (Rat) (pORF) |
ORF078049 |
ABM |
1.0 ug DNA |
EUR 506 |
TNNC2 ORF Vector (Human) (pORF) |
ORF010830 |
ABM |
1.0 ug DNA |
EUR 95 |
Tnnc2 ORF Vector (Mouse) (pORF) |
ORF060121 |
ABM |
1.0 ug DNA |
EUR 506 |
Troponin C Type 2, Fast (TNNC2) Antibody (Biotin) |
20-abx272325 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Troponin C, skeletal muscle (TNNC2) |
1-CSB-EP024010HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 45 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Troponin C, skeletal muscle(TNNC2) expressed in E.coli |
Tnnc2 sgRNA CRISPR Lentivector set (Rat) |
K6142201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Tnnc2 sgRNA CRISPR Lentivector set (Mouse) |
K3649001 |
ABM |
3 x 1.0 ug |
EUR 339 |
TNNC2 sgRNA CRISPR Lentivector set (Human) |
K2419301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Tnnc2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6142202 |
ABM |
1.0 ug DNA |
EUR 154 |
Tnnc2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6142203 |
ABM |
1.0 ug DNA |
EUR 154 |
Tnnc2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6142204 |
ABM |
1.0 ug DNA |
EUR 154 |
Tnnc2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3649002 |
ABM |
1.0 ug DNA |
EUR 154 |
Tnnc2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3649003 |
ABM |
1.0 ug DNA |
EUR 154 |
Tnnc2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3649004 |
ABM |
1.0 ug DNA |
EUR 154 |
TNNC2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2419302 |
ABM |
1.0 ug DNA |
EUR 154 |
TNNC2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2419303 |
ABM |
1.0 ug DNA |
EUR 154 |
TNNC2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2419304 |
ABM |
1.0 ug DNA |
EUR 154 |
TNNC2 Protein Vector (Rat) (pPB-C-His) |
PV312194 |
ABM |
500 ng |
EUR 603 |
TNNC2 Protein Vector (Rat) (pPB-N-His) |
PV312195 |
ABM |
500 ng |
EUR 603 |
TNNC2 Protein Vector (Rat) (pPM-C-HA) |
PV312196 |
ABM |
500 ng |
EUR 603 |
TNNC2 Protein Vector (Rat) (pPM-C-His) |
PV312197 |
ABM |
500 ng |
EUR 603 |
TNNC2 Protein Vector (Mouse) (pPB-C-His) |
PV240482 |
ABM |
500 ng |
EUR 603 |
TNNC2 Protein Vector (Mouse) (pPB-N-His) |
PV240483 |
ABM |
500 ng |
EUR 603 |
TNNC2 Protein Vector (Mouse) (pPM-C-HA) |
PV240484 |
ABM |
500 ng |
EUR 603 |
TNNC2 Protein Vector (Mouse) (pPM-C-His) |
PV240485 |
ABM |
500 ng |
EUR 603 |
Recombinant Troponin C Type 2, Fast (TNNC2) |
4-RPD228Hu01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P02585
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 45.0kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Troponin C Type 2, Fast expressed in: E.coli |
Recombinant Troponin C Type 2, Fast (TNNC2) |
4-RPD228Hu02 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P02585
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 64.6kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Troponin C Type 2, Fast expressed in: E.coli |
TNNC2 Protein Vector (Human) (pPB-C-His) |
PV043317 |
ABM |
500 ng |
EUR 329 |
TNNC2 Protein Vector (Human) (pPB-N-His) |
PV043318 |
ABM |
500 ng |
EUR 329 |
TNNC2 Protein Vector (Human) (pPM-C-HA) |
PV043319 |
ABM |
500 ng |
EUR 329 |
TNNC2 Protein Vector (Human) (pPM-C-His) |
PV043320 |
ABM |
500 ng |
EUR 329 |
Tnnc2 3'UTR Luciferase Stable Cell Line |
TU120917 |
ABM |
1.0 ml |
Ask for price |
Tnnc2 3'UTR GFP Stable Cell Line |
TU170917 |
ABM |
1.0 ml |
Ask for price |
Tnnc2 3'UTR Luciferase Stable Cell Line |
TU222269 |
ABM |
1.0 ml |
Ask for price |
TNNC2 3'UTR GFP Stable Cell Line |
TU076055 |
ABM |
1.0 ml |
EUR 1394 |
TNNC2 3'UTR Luciferase Stable Cell Line |
TU026055 |
ABM |
1.0 ml |
EUR 1394 |
Tnnc2 3'UTR GFP Stable Cell Line |
TU272269 |
ABM |
1.0 ml |
Ask for price |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
TNNC2 Rabbit Polyclonal Antibody