TNNC2 Rabbit Polyclonal Antibody

TNNC2 Polyclonal Antibody

ES10398-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TNNC2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

TNNC2 Polyclonal Antibody

ES10398-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TNNC2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

TNNC2 Rabbit pAb

A7740-100ul 100 ul
EUR 308

TNNC2 Rabbit pAb

A7740-200ul 200 ul
EUR 459

TNNC2 Rabbit pAb

A7740-20ul 20 ul
EUR 183

TNNC2 Rabbit pAb

A7740-50ul 50 ul
EUR 223

Human Troponin C Type 2, Fast (TNNC2) ELISA Kit

DLR-TNNC2-Hu-48T 48T
EUR 517
  • Should the Human Troponin C Type 2, Fast (TNNC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Troponin C Type 2, Fast (TNNC2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Troponin C Type 2, Fast (TNNC2) ELISA Kit

DLR-TNNC2-Hu-96T 96T
EUR 673
  • Should the Human Troponin C Type 2, Fast (TNNC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Troponin C Type 2, Fast (TNNC2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Troponin C Type 2, Fast (TNNC2) ELISA Kit

RDR-TNNC2-Hu-48Tests 48 Tests
EUR 544

Human Troponin C Type 2, Fast (TNNC2) ELISA Kit

RDR-TNNC2-Hu-96Tests 96 Tests
EUR 756

Human Troponin C Type 2, Fast (TNNC2) ELISA Kit

RD-TNNC2-Hu-48Tests 48 Tests
EUR 521

Human Troponin C Type 2, Fast (TNNC2) ELISA Kit

RD-TNNC2-Hu-96Tests 96 Tests
EUR 723

TNNC2 Antibody

47442-100ul 100ul
EUR 252

TNNC2 Antibody

1-CSB-PA024010ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TNNC2. Recognizes TNNC2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

TNNC2 Antibody

1-CSB-PA024010ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TNNC2. Recognizes TNNC2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

Rabbit TNNC2 ELISA Kit

ERTT0256 96Tests
EUR 521

Polyclonal TNNC2 Antibody(C-term)

AMM08263G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNNC2 (C-term). This antibody is tested and proven to work in the following applications:

TNNC2 Conjugated Antibody

C47442 100ul
EUR 397

anti- TNNC2 antibody

FNab08836 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: troponin C type 2 (fast)
  • Uniprot ID: P02585
  • Gene ID: 7125
  • Research Area: Neuroscience, Signal Transduction, Developmental biology
Description: Antibody raised against TNNC2

Anti-TNNC2 antibody

PAab08836 100 ug
EUR 386

Anti-TNNC2 antibody

STJ110051 100 µl
EUR 277
Description: Troponin (Tn), a key protein complex in the regulation of striated muscle contraction, is composed of 3 subunits. The Tn-I subunit inhibits actomyosin ATPase, the Tn-T subunit binds tropomyosin and Tn-C, while the Tn-C subunit binds calcium and overcomes the inhibitory action of the troponin complex on actin filaments. The protein encoded by this gene is the Tn-C subunit.

Anti-TNNC2 antibody

STJ191556 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TNNC2

TNNC2 siRNA

20-abx937666
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TNNC2 siRNA

20-abx937667
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-TNNC2

YF-PA24866 50 ul
EUR 334
Description: Mouse polyclonal to TNNC2

TNNC2 cloning plasmid

CSB-CL024010HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 483
  • Sequence: atgacggaccagcaggctgaggccaggtcctacctcagcgaagagatgatcgctgagttcaaggctgcctttgacatgtttgatgctgatggtggtggggacatcagcgtcaaggagttgggcacggtgatgaggatgctgggccagacacccaccaaggaggagctggacgccat
  • Show more
Description: A cloning plasmid for the TNNC2 gene.

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human)

4-PAD228Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2)

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human)

4-PAD228Hu02
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2)

Rabbit Troponin C, Skeletal Muscle (TNNC2) ELISA Kit

abx362622-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Troponin C, skeletal muscle, TNNC2 ELISA KIT

ELI-39995Ra 96 Tests
EUR 928

Troponin C Type 2 (TNNC2) Antibody

20-abx006037
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Troponin C Type 2 (TNNC2) Antibody

20-abx142271
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Troponin C Type 2 (TNNC2) Antibody

abx031096-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Troponin C Type 2 (TNNC2) Antibody

abx031096-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Troponin C Type 2 (TNNC2) Antibody

abx238836-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Troponin C Type 2 (TNNC2) Antibody

20-abx322212
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Troponin C Type 2 (TNNC2) Antibody

20-abx322296
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human TNNC2 ELISA Kit

EHT0256 96Tests
EUR 521

Bovine TNNC2 ELISA Kit

EBT0256 96Tests
EUR 521

Anserini TNNC2 ELISA Kit

EAT0256 96Tests
EUR 521

Chicken TNNC2 ELISA Kit

ECKT0256 96Tests
EUR 521

Canine TNNC2 ELISA Kit

ECT0256 96Tests
EUR 521

Goat TNNC2 ELISA Kit

EGTT0256 96Tests
EUR 521

TNNC2 ELISA KIT|Human

EF007216 96 Tests
EUR 689

Mouse TNNC2 shRNA Plasmid

20-abx973148
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TNNC2 shRNA Plasmid

20-abx954886
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Sheep TNNC2 ELISA Kit

EST0256 96Tests
EUR 521

Porcine TNNC2 ELISA Kit

EPT0256 96Tests
EUR 521

Rat TNNC2 ELISA Kit

ERT0256 96Tests
EUR 521

Monkey TNNC2 ELISA Kit

EMKT0256 96Tests
EUR 521

Mouse TNNC2 ELISA Kit

EMT0256 96Tests
EUR 521

TNNC2 Recombinant Protein (Rat)

RP234143 100 ug Ask for price

TNNC2 Recombinant Protein (Human)

RP032488 100 ug Ask for price

TNNC2 Recombinant Protein (Mouse)

RP180359 100 ug Ask for price

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), APC

4-PAD228Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with APC.

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), Biotinylated

4-PAD228Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with Biotin.

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), Cy3

4-PAD228Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with Cy3.

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), FITC

4-PAD228Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with FITC.

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), HRP

4-PAD228Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with HRP.

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), PE

4-PAD228Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with PE.

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), APC

4-PAD228Hu02-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with APC.

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), Biotinylated

4-PAD228Hu02-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with Biotin.

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), Cy3

4-PAD228Hu02-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with Cy3.

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), FITC

4-PAD228Hu02-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with FITC.

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), HRP

4-PAD228Hu02-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with HRP.

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), PE

4-PAD228Hu02-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with PE.

ELISA kit for Rabbit Troponin C, skeletal muscle (TNNC2)

KTE90012-48T 48T
EUR 354
  • The troponin C protein is the calcium-binding subunit of the troponin complex. It occurs in 2 distinct isoforms: fast skeletal troponin C, which is expressed exclusively in fast-twitch skeletal muscle, and slow/cardiac troponin C, which is expressed
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Troponin C, skeletal muscle (TNNC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Troponin C, skeletal muscle (TNNC2)

KTE90012-5platesof96wells 5 plates of 96 wells
EUR 2252
  • The troponin C protein is the calcium-binding subunit of the troponin complex. It occurs in 2 distinct isoforms: fast skeletal troponin C, which is expressed exclusively in fast-twitch skeletal muscle, and slow/cardiac troponin C, which is expressed
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Troponin C, skeletal muscle (TNNC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Troponin C, skeletal muscle (TNNC2)

KTE90012-96T 96T
EUR 572
  • The troponin C protein is the calcium-binding subunit of the troponin complex. It occurs in 2 distinct isoforms: fast skeletal troponin C, which is expressed exclusively in fast-twitch skeletal muscle, and slow/cardiac troponin C, which is expressed
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Troponin C, skeletal muscle (TNNC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), APC-Cy7

4-PAD228Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with APC-Cy7.

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), APC-Cy7

4-PAD228Hu02-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with APC-Cy7.

Troponin C Type 2, Fast (TNNC2) Antibody

20-abx102494
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Troponin C Type 2, Fast (TNNC2) Antibody

20-abx128479
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Guinea Pig TNNC2 ELISA Kit

EGT0256 96Tests
EUR 521

Tnnc2 ORF Vector (Rat) (pORF)

ORF078049 1.0 ug DNA
EUR 506

TNNC2 ORF Vector (Human) (pORF)

ORF010830 1.0 ug DNA
EUR 95

Tnnc2 ORF Vector (Mouse) (pORF)

ORF060121 1.0 ug DNA
EUR 506

Troponin C Type 2, Fast (TNNC2) Antibody (Biotin)

20-abx272325
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Troponin C, skeletal muscle (TNNC2)

1-CSB-EP024010HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 45 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Troponin C, skeletal muscle(TNNC2) expressed in E.coli

Tnnc2 sgRNA CRISPR Lentivector set (Rat)

K6142201 3 x 1.0 ug
EUR 339

Tnnc2 sgRNA CRISPR Lentivector set (Mouse)

K3649001 3 x 1.0 ug
EUR 339

TNNC2 sgRNA CRISPR Lentivector set (Human)

K2419301 3 x 1.0 ug
EUR 339

Tnnc2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6142202 1.0 ug DNA
EUR 154

Tnnc2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6142203 1.0 ug DNA
EUR 154

Tnnc2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6142204 1.0 ug DNA
EUR 154

Tnnc2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3649002 1.0 ug DNA
EUR 154

Tnnc2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3649003 1.0 ug DNA
EUR 154

Tnnc2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3649004 1.0 ug DNA
EUR 154

TNNC2 sgRNA CRISPR Lentivector (Human) (Target 1)

K2419302 1.0 ug DNA
EUR 154

TNNC2 sgRNA CRISPR Lentivector (Human) (Target 2)

K2419303 1.0 ug DNA
EUR 154

TNNC2 sgRNA CRISPR Lentivector (Human) (Target 3)

K2419304 1.0 ug DNA
EUR 154

TNNC2 Protein Vector (Rat) (pPB-C-His)

PV312194 500 ng
EUR 603

TNNC2 Protein Vector (Rat) (pPB-N-His)

PV312195 500 ng
EUR 603

TNNC2 Protein Vector (Rat) (pPM-C-HA)

PV312196 500 ng
EUR 603

TNNC2 Protein Vector (Rat) (pPM-C-His)

PV312197 500 ng
EUR 603

TNNC2 Protein Vector (Mouse) (pPB-C-His)

PV240482 500 ng
EUR 603

TNNC2 Protein Vector (Mouse) (pPB-N-His)

PV240483 500 ng
EUR 603

TNNC2 Protein Vector (Mouse) (pPM-C-HA)

PV240484 500 ng
EUR 603

TNNC2 Protein Vector (Mouse) (pPM-C-His)

PV240485 500 ng
EUR 603

Recombinant Troponin C Type 2, Fast (TNNC2)

4-RPD228Hu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P02585
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 45.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Troponin C Type 2, Fast expressed in: E.coli

Recombinant Troponin C Type 2, Fast (TNNC2)

4-RPD228Hu02
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P02585
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 64.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Troponin C Type 2, Fast expressed in: E.coli

TNNC2 Protein Vector (Human) (pPB-C-His)

PV043317 500 ng
EUR 329

TNNC2 Protein Vector (Human) (pPB-N-His)

PV043318 500 ng
EUR 329

TNNC2 Protein Vector (Human) (pPM-C-HA)

PV043319 500 ng
EUR 329

TNNC2 Protein Vector (Human) (pPM-C-His)

PV043320 500 ng
EUR 329

Tnnc2 3'UTR Luciferase Stable Cell Line

TU120917 1.0 ml Ask for price

Tnnc2 3'UTR GFP Stable Cell Line

TU170917 1.0 ml Ask for price

Tnnc2 3'UTR Luciferase Stable Cell Line

TU222269 1.0 ml Ask for price

TNNC2 3'UTR GFP Stable Cell Line

TU076055 1.0 ml
EUR 1394

TNNC2 3'UTR Luciferase Stable Cell Line

TU026055 1.0 ml
EUR 1394

Tnnc2 3'UTR GFP Stable Cell Line

TU272269 1.0 ml Ask for price

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody

ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody

ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

TNNC2 Rabbit Polyclonal Antibody