 TNNC2 Polyclonal Antibody |
|
ABP60720-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human TNNC2 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of TNNC2 from Human, Mouse. This TNNC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TNNC2 protein |
TNNC2 Polyclonal Antibody |
|
ABP60720-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human TNNC2 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of TNNC2 from Human, Mouse. This TNNC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TNNC2 protein |
 TNNC2 Rabbit pAb |
|
A7740-100ul |
Abclonal |
100 ul |
EUR 308 |
TNNC2 Rabbit pAb |
|
A7740-200ul |
Abclonal |
200 ul |
EUR 459 |
TNNC2 Rabbit pAb |
|
A7740-20ul |
Abclonal |
20 ul |
EUR 183 |
TNNC2 Rabbit pAb |
|
A7740-50ul |
Abclonal |
50 ul |
EUR 223 |
 ELISA Kit) Human Troponin C Type 2, Fast (TNNC2) ELISA Kit |
|
DLR-TNNC2-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Troponin C Type 2, Fast (TNNC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Troponin C Type 2, Fast (TNNC2) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Troponin C Type 2, Fast (TNNC2) ELISA Kit |
|
DLR-TNNC2-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Troponin C Type 2, Fast (TNNC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Troponin C Type 2, Fast (TNNC2) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Troponin C Type 2, Fast (TNNC2) ELISA Kit |
|
RDR-TNNC2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Troponin C Type 2, Fast (TNNC2) ELISA Kit |
|
RDR-TNNC2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Troponin C Type 2, Fast (TNNC2) ELISA Kit |
|
RD-TNNC2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Troponin C Type 2, Fast (TNNC2) ELISA Kit |
|
RD-TNNC2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
 TNNC2 Antibody |
|
47442-100ul |
SAB |
100ul |
EUR 252 |
TNNC2 Antibody |
|
1-CSB-PA024010ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against TNNC2. Recognizes TNNC2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000 |
TNNC2 Antibody |
|
1-CSB-PA024010ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against TNNC2. Recognizes TNNC2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
 Rabbit TNNC2 ELISA Kit |
|
ERTT0256 |
Abclonal |
96Tests |
EUR 521 |
) Polyclonal TNNC2 Antibody(C-term) |
|
AMM08263G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNNC2 (C-term). This antibody is tested and proven to work in the following applications: |
 TNNC2 Conjugated Antibody |
|
C47442 |
SAB |
100ul |
EUR 397 |
 anti- TNNC2 antibody |
|
FNab08836 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: troponin C type 2 (fast)
- Uniprot ID: P02585
- Gene ID: 7125
- Research Area: Neuroscience, Signal Transduction, Developmental biology
|
|
Description: Antibody raised against TNNC2 |
 Anti-TNNC2 antibody |
|
STJ110051 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: Troponin (Tn), a key protein complex in the regulation of striated muscle contraction, is composed of 3 subunits. The Tn-I subunit inhibits actomyosin ATPase, the Tn-T subunit binds tropomyosin and Tn-C, while the Tn-C subunit binds calcium and overcomes the inhibitory action of the troponin complex on actin filaments. The protein encoded by this gene is the Tn-C subunit. |
Anti-TNNC2 antibody |
|
STJ191556 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to TNNC2 |
 TNNC2 siRNA |
|
20-abx937666 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TNNC2 siRNA |
|
20-abx937667 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-TNNC2 |
|
YF-PA24866 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to TNNC2 |
 TNNC2 cloning plasmid |
|
CSB-CL024010HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 483
- Sequence: atgacggaccagcaggctgaggccaggtcctacctcagcgaagagatgatcgctgagttcaaggctgcctttgacatgtttgatgctgatggtggtggggacatcagcgtcaaggagttgggcacggtgatgaggatgctgggccagacacccaccaaggaggagctggacgccat
- Show more
|
|
Description: A cloning plasmid for the TNNC2 gene. |
 Polyclonal Antibody (Human)) Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human) |
|
4-PAD228Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2) |
Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human) |
|
4-PAD228Hu02 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2) |
 ELISA Kit) Rabbit Troponin C, Skeletal Muscle (TNNC2) ELISA Kit |
|
abx362622-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 Rabbit Troponin C, skeletal muscle, TNNC2 ELISA KIT |
|
ELI-39995Ra |
Lifescience Market |
96 Tests |
EUR 928 |
 Antibody) Troponin C Type 2 (TNNC2) Antibody |
|
20-abx142271 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Troponin C Type 2 (TNNC2) Antibody |
|
20-abx006037 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Troponin C Type 2 (TNNC2) Antibody |
|
abx031096-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Troponin C Type 2 (TNNC2) Antibody |
|
abx031096-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Troponin C Type 2 (TNNC2) Antibody |
|
20-abx322212 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Troponin C Type 2 (TNNC2) Antibody |
|
20-abx322296 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Troponin C Type 2 (TNNC2) Antibody |
|
abx238836-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
 Polyclonal Antibody (Human), APC) Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), APC |
|
4-PAD228Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with APC. |
 Polyclonal Antibody (Human), Biotinylated) Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), Biotinylated |
|
4-PAD228Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human), Cy3) Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), Cy3 |
|
4-PAD228Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human), FITC) Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), FITC |
|
4-PAD228Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human), HRP) Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), HRP |
|
4-PAD228Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human), PE) Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), PE |
|
4-PAD228Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with PE. |
Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), APC |
|
4-PAD228Hu02-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with APC. |
Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), Biotinylated |
|
4-PAD228Hu02-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with Biotin. |
Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), Cy3 |
|
4-PAD228Hu02-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with Cy3. |
Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), FITC |
|
4-PAD228Hu02-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with FITC. |
Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), HRP |
|
4-PAD228Hu02-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with HRP. |
Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), PE |
|
4-PAD228Hu02-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with PE. |
 Human TNNC2 ELISA Kit |
|
EHT0256 |
Abclonal |
96Tests |
EUR 521 |
 Goat TNNC2 ELISA Kit |
|
EGTT0256 |
Abclonal |
96Tests |
EUR 521 |
 Bovine TNNC2 ELISA Kit |
|
EBT0256 |
Abclonal |
96Tests |
EUR 521 |
 Chicken TNNC2 ELISA Kit |
|
ECKT0256 |
Abclonal |
96Tests |
EUR 521 |
 Anserini TNNC2 ELISA Kit |
|
EAT0256 |
Abclonal |
96Tests |
EUR 521 |
 Canine TNNC2 ELISA Kit |
|
ECT0256 |
Abclonal |
96Tests |
EUR 521 |
 Porcine TNNC2 ELISA Kit |
|
EPT0256 |
Abclonal |
96Tests |
EUR 521 |
 Rat TNNC2 ELISA Kit |
|
ERT0256 |
Abclonal |
96Tests |
EUR 521 |
 Sheep TNNC2 ELISA Kit |
|
EST0256 |
Abclonal |
96Tests |
EUR 521 |
 Monkey TNNC2 ELISA Kit |
|
EMKT0256 |
Abclonal |
96Tests |
EUR 521 |
 Mouse TNNC2 ELISA Kit |
|
EMT0256 |
Abclonal |
96Tests |
EUR 521 |
 Human TNNC2 shRNA Plasmid |
|
20-abx954886 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse TNNC2 shRNA Plasmid |
|
20-abx973148 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) TNNC2 Recombinant Protein (Human) |
|
RP032488 |
ABM |
100 ug |
Ask for price |
) TNNC2 Recombinant Protein (Rat) |
|
RP234143 |
ABM |
100 ug |
Ask for price |
) TNNC2 Recombinant Protein (Mouse) |
|
RP180359 |
ABM |
100 ug |
Ask for price |
) ELISA kit for Rabbit Troponin C, skeletal muscle (TNNC2) |
|
KTE90012-48T |
Abbkine |
48T |
EUR 354 |
- The troponin C protein is the calcium-binding subunit of the troponin complex. It occurs in 2 distinct isoforms: fast skeletal troponin C, which is expressed exclusively in fast-twitch skeletal muscle, and slow/cardiac troponin C, which is expressed
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Rabbit Troponin C, skeletal muscle (TNNC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rabbit Troponin C, skeletal muscle (TNNC2) |
|
KTE90012-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- The troponin C protein is the calcium-binding subunit of the troponin complex. It occurs in 2 distinct isoforms: fast skeletal troponin C, which is expressed exclusively in fast-twitch skeletal muscle, and slow/cardiac troponin C, which is expressed
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Rabbit Troponin C, skeletal muscle (TNNC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rabbit Troponin C, skeletal muscle (TNNC2) |
|
KTE90012-96T |
Abbkine |
96T |
EUR 572 |
- The troponin C protein is the calcium-binding subunit of the troponin complex. It occurs in 2 distinct isoforms: fast skeletal troponin C, which is expressed exclusively in fast-twitch skeletal muscle, and slow/cardiac troponin C, which is expressed
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Rabbit Troponin C, skeletal muscle (TNNC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
 Polyclonal Antibody (Human), APC-Cy7) Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), APC-Cy7 |
|
4-PAD228Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with APC-Cy7. |
Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), APC-Cy7 |
|
4-PAD228Hu02-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNC2 (Thr2~Gln160)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with APC-Cy7. |
 Antibody) Troponin C Type 2, Fast (TNNC2) Antibody |
|
20-abx128479 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Troponin C Type 2, Fast (TNNC2) Antibody |
|
20-abx102494 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
 Guinea Pig TNNC2 ELISA Kit |
|
EGT0256 |
Abclonal |
96Tests |
EUR 521 |
 (pORF)) Tnnc2 ORF Vector (Mouse) (pORF) |
|
ORF060121 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Tnnc2 ORF Vector (Rat) (pORF) |
|
ORF078049 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) TNNC2 ORF Vector (Human) (pORF) |
|
ORF010830 |
ABM |
1.0 ug DNA |
EUR 95 |
 (OKCD01746)) TNNC2 ELISA Kit (Human) (OKCD01746) |
|
OKCD01746 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
|
Description: Description of target: Troponin is the central regulatory protein of striated muscle contraction. Tn consists of three components: Tn-I which is the inhibitor of actomyosin ATPase, Tn-T which contains the binding site for tropomyosin and Tn-C. The binding of calcium to Tn-C abolishes the inhibitory action of Tn on actin filaments. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 13.5 pg/mL |
 Antibody (Biotin)) Troponin C Type 2, Fast (TNNC2) Antibody (Biotin) |
|
20-abx272325 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
) TNNC2 sgRNA CRISPR Lentivector set (Human) |
|
K2419301 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Tnnc2 sgRNA CRISPR Lentivector set (Rat) |
|
K6142201 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Human Troponin C, skeletal muscle (TNNC2) |
|
1-CSB-EP024010HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 45 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Human Troponin C, skeletal muscle(TNNC2) expressed in E.coli |
) Tnnc2 sgRNA CRISPR Lentivector set (Mouse) |
|
K3649001 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) TNNC2 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2419302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) TNNC2 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2419303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) TNNC2 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2419304 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Tnnc2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6142202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Tnnc2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6142203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Tnnc2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6142204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Tnnc2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3649002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Tnnc2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3649003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Tnnc2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3649004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) TNNC2 Protein Vector (Human) (pPB-C-His) |
|
PV043317 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) TNNC2 Protein Vector (Human) (pPB-N-His) |
|
PV043318 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) TNNC2 Protein Vector (Human) (pPM-C-HA) |
|
PV043319 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) TNNC2 Protein Vector (Human) (pPM-C-His) |
|
PV043320 |
ABM |
500 ng |
EUR 329 |
) Recombinant Troponin C Type 2, Fast (TNNC2) |
|
4-RPD228Hu01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P02585
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 45.0kDa
- Isoelectric Point: Inquire
|
|
Description: Recombinant Human Troponin C Type 2, Fast expressed in: E.coli |
Recombinant Troponin C Type 2, Fast (TNNC2) |
|
4-RPD228Hu02 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P02585
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 64.6kDa
- Isoelectric Point: Inquire
|
|
Description: Recombinant Human Troponin C Type 2, Fast expressed in: E.coli |
 (pPB-C-His)) TNNC2 Protein Vector (Rat) (pPB-C-His) |
|
PV312194 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) TNNC2 Protein Vector (Rat) (pPB-N-His) |
|
PV312195 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) TNNC2 Protein Vector (Rat) (pPM-C-HA) |
|
PV312196 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) TNNC2 Protein Vector (Rat) (pPM-C-His) |
|
PV312197 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) TNNC2 Protein Vector (Mouse) (pPB-C-His) |
|
PV240482 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) TNNC2 Protein Vector (Mouse) (pPB-N-His) |
|
PV240483 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) TNNC2 Protein Vector (Mouse) (pPM-C-HA) |
|
PV240484 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) TNNC2 Protein Vector (Mouse) (pPM-C-His) |
|
PV240485 |
ABM |
500 ng |
EUR 603 |
 Tnnc2 3'UTR GFP Stable Cell Line |
|
TU170917 |
ABM |
1.0 ml |
Ask for price |
 TNNC2 3'UTR GFP Stable Cell Line |
|
TU076055 |
ABM |
1.0 ml |
EUR 1394 |
 Tnnc2 3'UTR Luciferase Stable Cell Line |
|
TU120917 |
ABM |
1.0 ml |
Ask for price |
 TNNC2 3'UTR Luciferase Stable Cell Line |
|
TU026055 |
ABM |
1.0 ml |
EUR 1394 |
Tnnc2 3'UTR Luciferase Stable Cell Line |
|
TU222269 |
ABM |
1.0 ml |
Ask for price |
Tnnc2 3'UTR GFP Stable Cell Line |
|
TU272269 |
ABM |
1.0 ml |
Ask for price |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG14L Rabbit Polyclonal Antibody |
|
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
|
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NBR1 Rabbit Polyclonal Antibody |
|
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Gab1 Rabbit Polyclonal Antibody |
|
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
|
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ERK1 Rabbit Polyclonal Antibody |
|
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
|
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
TNNC2 Rabbit Polyclonal Antibody
