Biocat Net

Amine biocat 3.0

TNNC2 Rabbit Polyclonal Antibody

TNNC2 Polyclonal Antibody

ABP60720-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TNNC2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TNNC2 from Human, Mouse. This TNNC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TNNC2 protein

TNNC2 Polyclonal Antibody

ABP60720-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TNNC2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TNNC2 from Human, Mouse. This TNNC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TNNC2 protein

TNNC2 Rabbit pAb

A7740-100ul 100 ul
EUR 308

TNNC2 Rabbit pAb

A7740-200ul 200 ul
EUR 459

TNNC2 Rabbit pAb

A7740-20ul 20 ul
EUR 183

TNNC2 Rabbit pAb

A7740-50ul 50 ul
EUR 223

Human Troponin C Type 2, Fast (TNNC2) ELISA Kit

DLR-TNNC2-Hu-48T 48T
EUR 517
  • Should the Human Troponin C Type 2, Fast (TNNC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Troponin C Type 2, Fast (TNNC2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Troponin C Type 2, Fast (TNNC2) ELISA Kit

DLR-TNNC2-Hu-96T 96T
EUR 673
  • Should the Human Troponin C Type 2, Fast (TNNC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Troponin C Type 2, Fast (TNNC2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Troponin C Type 2, Fast (TNNC2) ELISA Kit

RDR-TNNC2-Hu-48Tests 48 Tests
EUR 544

Human Troponin C Type 2, Fast (TNNC2) ELISA Kit

RDR-TNNC2-Hu-96Tests 96 Tests
EUR 756

Human Troponin C Type 2, Fast (TNNC2) ELISA Kit

RD-TNNC2-Hu-48Tests 48 Tests
EUR 521

Human Troponin C Type 2, Fast (TNNC2) ELISA Kit

RD-TNNC2-Hu-96Tests 96 Tests
EUR 723

TNNC2 Antibody

47442-100ul 100ul
EUR 252

TNNC2 Antibody

1-CSB-PA024010ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TNNC2. Recognizes TNNC2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

TNNC2 Antibody

1-CSB-PA024010ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TNNC2. Recognizes TNNC2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

Rabbit TNNC2 ELISA Kit

ERTT0256 96Tests
EUR 521

Polyclonal TNNC2 Antibody(C-term)

AMM08263G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNNC2 (C-term). This antibody is tested and proven to work in the following applications:

TNNC2 Conjugated Antibody

C47442 100ul
EUR 397

anti- TNNC2 antibody

FNab08836 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: troponin C type 2 (fast)
  • Uniprot ID: P02585
  • Gene ID: 7125
  • Research Area: Neuroscience, Signal Transduction, Developmental biology
Description: Antibody raised against TNNC2

Anti-TNNC2 antibody

PAab08836 100 ug
EUR 386

Anti-TNNC2 antibody

STJ110051 100 µl
EUR 277
Description: Troponin (Tn), a key protein complex in the regulation of striated muscle contraction, is composed of 3 subunits. The Tn-I subunit inhibits actomyosin ATPase, the Tn-T subunit binds tropomyosin and Tn-C, while the Tn-C subunit binds calcium and overcomes the inhibitory action of the troponin complex on actin filaments. The protein encoded by this gene is the Tn-C subunit.

Anti-TNNC2 antibody

STJ191556 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TNNC2

TNNC2 siRNA

20-abx937666
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TNNC2 siRNA

20-abx937667
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-TNNC2

YF-PA24866 50 ul
EUR 334
Description: Mouse polyclonal to TNNC2

TNNC2 cloning plasmid

CSB-CL024010HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 483
  • Sequence: atgacggaccagcaggctgaggccaggtcctacctcagcgaagagatgatcgctgagttcaaggctgcctttgacatgtttgatgctgatggtggtggggacatcagcgtcaaggagttgggcacggtgatgaggatgctgggccagacacccaccaaggaggagctggacgccat
  • Show more
Description: A cloning plasmid for the TNNC2 gene.

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human)

4-PAD228Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2)

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human)

4-PAD228Hu02
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2)

Rabbit Troponin C, Skeletal Muscle (TNNC2) ELISA Kit

abx362622-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Troponin C, skeletal muscle, TNNC2 ELISA KIT

ELI-39995Ra 96 Tests
EUR 928

Troponin C Type 2 (TNNC2) Antibody

20-abx142271
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Troponin C Type 2 (TNNC2) Antibody

20-abx006037
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Troponin C Type 2 (TNNC2) Antibody

abx031096-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Troponin C Type 2 (TNNC2) Antibody

abx031096-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Troponin C Type 2 (TNNC2) Antibody

20-abx322212
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Troponin C Type 2 (TNNC2) Antibody

20-abx322296
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Troponin C Type 2 (TNNC2) Antibody

abx238836-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), APC

4-PAD228Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with APC.

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), Biotinylated

4-PAD228Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with Biotin.

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), Cy3

4-PAD228Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with Cy3.

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), FITC

4-PAD228Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with FITC.

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), HRP

4-PAD228Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with HRP.

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), PE

4-PAD228Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with PE.

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), APC

4-PAD228Hu02-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with APC.

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), Biotinylated

4-PAD228Hu02-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with Biotin.

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), Cy3

4-PAD228Hu02-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with Cy3.

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), FITC

4-PAD228Hu02-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with FITC.

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), HRP

4-PAD228Hu02-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with HRP.

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), PE

4-PAD228Hu02-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with PE.

Human TNNC2 ELISA Kit

EHT0256 96Tests
EUR 521

Goat TNNC2 ELISA Kit

EGTT0256 96Tests
EUR 521

Bovine TNNC2 ELISA Kit

EBT0256 96Tests
EUR 521

Chicken TNNC2 ELISA Kit

ECKT0256 96Tests
EUR 521

Anserini TNNC2 ELISA Kit

EAT0256 96Tests
EUR 521

Canine TNNC2 ELISA Kit

ECT0256 96Tests
EUR 521

TNNC2 ELISA KIT|Human

EF007216 96 Tests
EUR 689

Porcine TNNC2 ELISA Kit

EPT0256 96Tests
EUR 521

Rat TNNC2 ELISA Kit

ERT0256 96Tests
EUR 521

Sheep TNNC2 ELISA Kit

EST0256 96Tests
EUR 521

Monkey TNNC2 ELISA Kit

EMKT0256 96Tests
EUR 521

Mouse TNNC2 ELISA Kit

EMT0256 96Tests
EUR 521

Human TNNC2 shRNA Plasmid

20-abx954886
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse TNNC2 shRNA Plasmid

20-abx973148
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TNNC2 Recombinant Protein (Human)

RP032488 100 ug Ask for price

TNNC2 Recombinant Protein (Rat)

RP234143 100 ug Ask for price

TNNC2 Recombinant Protein (Mouse)

RP180359 100 ug Ask for price

ELISA kit for Rabbit Troponin C, skeletal muscle (TNNC2)

KTE90012-48T 48T
EUR 354
  • The troponin C protein is the calcium-binding subunit of the troponin complex. It occurs in 2 distinct isoforms: fast skeletal troponin C, which is expressed exclusively in fast-twitch skeletal muscle, and slow/cardiac troponin C, which is expressed
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Troponin C, skeletal muscle (TNNC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Troponin C, skeletal muscle (TNNC2)

KTE90012-5platesof96wells 5 plates of 96 wells
EUR 2252
  • The troponin C protein is the calcium-binding subunit of the troponin complex. It occurs in 2 distinct isoforms: fast skeletal troponin C, which is expressed exclusively in fast-twitch skeletal muscle, and slow/cardiac troponin C, which is expressed
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Troponin C, skeletal muscle (TNNC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Troponin C, skeletal muscle (TNNC2)

KTE90012-96T 96T
EUR 572
  • The troponin C protein is the calcium-binding subunit of the troponin complex. It occurs in 2 distinct isoforms: fast skeletal troponin C, which is expressed exclusively in fast-twitch skeletal muscle, and slow/cardiac troponin C, which is expressed
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Troponin C, skeletal muscle (TNNC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), APC-Cy7

4-PAD228Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with APC-Cy7.

Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human), APC-Cy7

4-PAD228Hu02-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2). This antibody is labeled with APC-Cy7.

Troponin C Type 2, Fast (TNNC2) Antibody

20-abx128479
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Troponin C Type 2, Fast (TNNC2) Antibody

20-abx102494
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Guinea Pig TNNC2 ELISA Kit

EGT0256 96Tests
EUR 521

Tnnc2 ORF Vector (Mouse) (pORF)

ORF060121 1.0 ug DNA
EUR 506

Tnnc2 ORF Vector (Rat) (pORF)

ORF078049 1.0 ug DNA
EUR 506

TNNC2 ORF Vector (Human) (pORF)

ORF010830 1.0 ug DNA
EUR 95

TNNC2 ELISA Kit (Human) (OKCD01746)

OKCD01746 96 Wells
EUR 831
Description: Description of target: Troponin is the central regulatory protein of striated muscle contraction. Tn consists of three components: Tn-I which is the inhibitor of actomyosin ATPase, Tn-T which contains the binding site for tropomyosin and Tn-C. The binding of calcium to Tn-C abolishes the inhibitory action of Tn on actin filaments. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 13.5 pg/mL

Troponin C Type 2, Fast (TNNC2) Antibody (Biotin)

20-abx272325
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

TNNC2 sgRNA CRISPR Lentivector set (Human)

K2419301 3 x 1.0 ug
EUR 339

Tnnc2 sgRNA CRISPR Lentivector set (Rat)

K6142201 3 x 1.0 ug
EUR 339

Human Troponin C, skeletal muscle (TNNC2)

1-CSB-EP024010HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 45 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Troponin C, skeletal muscle(TNNC2) expressed in E.coli

Tnnc2 sgRNA CRISPR Lentivector set (Mouse)

K3649001 3 x 1.0 ug
EUR 339

TNNC2 sgRNA CRISPR Lentivector (Human) (Target 1)

K2419302 1.0 ug DNA
EUR 154

TNNC2 sgRNA CRISPR Lentivector (Human) (Target 2)

K2419303 1.0 ug DNA
EUR 154

TNNC2 sgRNA CRISPR Lentivector (Human) (Target 3)

K2419304 1.0 ug DNA
EUR 154

Tnnc2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6142202 1.0 ug DNA
EUR 154

Tnnc2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6142203 1.0 ug DNA
EUR 154

Tnnc2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6142204 1.0 ug DNA
EUR 154

Tnnc2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3649002 1.0 ug DNA
EUR 154

Tnnc2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3649003 1.0 ug DNA
EUR 154

Tnnc2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3649004 1.0 ug DNA
EUR 154

TNNC2 Protein Vector (Human) (pPB-C-His)

PV043317 500 ng
EUR 329

TNNC2 Protein Vector (Human) (pPB-N-His)

PV043318 500 ng
EUR 329

TNNC2 Protein Vector (Human) (pPM-C-HA)

PV043319 500 ng
EUR 329

TNNC2 Protein Vector (Human) (pPM-C-His)

PV043320 500 ng
EUR 329

Recombinant Troponin C Type 2, Fast (TNNC2)

4-RPD228Hu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P02585
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 45.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Troponin C Type 2, Fast expressed in: E.coli

Recombinant Troponin C Type 2, Fast (TNNC2)

4-RPD228Hu02
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P02585
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 64.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Troponin C Type 2, Fast expressed in: E.coli

TNNC2 Protein Vector (Rat) (pPB-C-His)

PV312194 500 ng
EUR 603

TNNC2 Protein Vector (Rat) (pPB-N-His)

PV312195 500 ng
EUR 603

TNNC2 Protein Vector (Rat) (pPM-C-HA)

PV312196 500 ng
EUR 603

TNNC2 Protein Vector (Rat) (pPM-C-His)

PV312197 500 ng
EUR 603

TNNC2 Protein Vector (Mouse) (pPB-C-His)

PV240482 500 ng
EUR 603

TNNC2 Protein Vector (Mouse) (pPB-N-His)

PV240483 500 ng
EUR 603

TNNC2 Protein Vector (Mouse) (pPM-C-HA)

PV240484 500 ng
EUR 603

TNNC2 Protein Vector (Mouse) (pPM-C-His)

PV240485 500 ng
EUR 603

Tnnc2 3'UTR GFP Stable Cell Line

TU170917 1.0 ml Ask for price

TNNC2 3'UTR GFP Stable Cell Line

TU076055 1.0 ml
EUR 1394

Tnnc2 3'UTR Luciferase Stable Cell Line

TU120917 1.0 ml Ask for price

TNNC2 3'UTR Luciferase Stable Cell Line

TU026055 1.0 ml
EUR 1394

Tnnc2 3'UTR Luciferase Stable Cell Line

TU222269 1.0 ml Ask for price

Tnnc2 3'UTR GFP Stable Cell Line

TU272269 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

TNNC2 Rabbit Polyclonal Antibody