TNNT1 Rabbit Polyclonal Antibody

TNNT1 Rabbit pAb

A10354-100ul 100 ul
EUR 308

TNNT1 Rabbit pAb

A10354-200ul 200 ul
EUR 459

TNNT1 Rabbit pAb

A10354-20ul 20 ul
EUR 183

TNNT1 Rabbit pAb

A10354-50ul 50 ul
EUR 223

Polyclonal TNNT1 / TNT Antibody (Internal)

AMM08272G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TNNT1 / TNT (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal TNNT1 Antibody (internal region)

AMM08273G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TNNT1 (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal TNNT1 antibody - middle region

AMM08274G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNNT1 - middle region. This antibody is tested and proven to work in the following applications:

TNNT1 antibody

70R-20907 50 ul
EUR 435
Description: Rabbit polyclonal TNNT1 antibody

TNNT1 Antibody

46287-100ul 100ul
EUR 252

TNNT1 Antibody

46287-50ul 50ul
EUR 187

TNNT1 Antibody

DF9976 200ul
EUR 304
Description: TNNT1 Antibody detects endogenous levels of total TNNT1.

TNNT1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TNNT1. Recognizes TNNT1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TNNT1 Antibody

ABD9976 100 ug
EUR 438

Human Troponin T Type 1, Slow Skeletal (TNNT1) ELISA Kit

DLR-TNNT1-Hu-48T 48T
EUR 517
  • Should the Human Troponin T Type 1, Slow Skeletal (TNNT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Troponin T Type 1, Slow Skeletal (TNNT1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Troponin T Type 1, Slow Skeletal (TNNT1) ELISA Kit

DLR-TNNT1-Hu-96T 96T
EUR 673
  • Should the Human Troponin T Type 1, Slow Skeletal (TNNT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Troponin T Type 1, Slow Skeletal (TNNT1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Troponin T Type 1, Slow Skeletal (TNNT1) ELISA Kit

DLR-TNNT1-Mu-48T 48T
EUR 527
  • Should the Mouse Troponin T Type 1, Slow Skeletal (TNNT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Troponin T Type 1, Slow Skeletal (TNNT1) in samples from serum, plasma or other biological fluids.

Mouse Troponin T Type 1, Slow Skeletal (TNNT1) ELISA Kit

DLR-TNNT1-Mu-96T 96T
EUR 688
  • Should the Mouse Troponin T Type 1, Slow Skeletal (TNNT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Troponin T Type 1, Slow Skeletal (TNNT1) in samples from serum, plasma or other biological fluids.

Rat Troponin T Type 1, Slow Skeletal (TNNT1) ELISA Kit

DLR-TNNT1-Ra-48T 48T
EUR 549
  • Should the Rat Troponin T Type 1, Slow Skeletal (TNNT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Troponin T Type 1, Slow Skeletal (TNNT1) in samples from serum, plasma or other biological fluids.

Rat Troponin T Type 1, Slow Skeletal (TNNT1) ELISA Kit

DLR-TNNT1-Ra-96T 96T
EUR 718
  • Should the Rat Troponin T Type 1, Slow Skeletal (TNNT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Troponin T Type 1, Slow Skeletal (TNNT1) in samples from serum, plasma or other biological fluids.

Human Troponin T Type 1, Slow Skeletal (TNNT1) ELISA Kit

RDR-TNNT1-Hu-48Tests 48 Tests
EUR 544

Human Troponin T Type 1, Slow Skeletal (TNNT1) ELISA Kit

RDR-TNNT1-Hu-96Tests 96 Tests
EUR 756

Mouse Troponin T Type 1, Slow Skeletal (TNNT1) ELISA Kit

RDR-TNNT1-Mu-48Tests 48 Tests
EUR 557

Mouse Troponin T Type 1, Slow Skeletal (TNNT1) ELISA Kit

RDR-TNNT1-Mu-96Tests 96 Tests
EUR 774

Rat Troponin T Type 1, Slow Skeletal (TNNT1) ELISA Kit

RDR-TNNT1-Ra-48Tests 48 Tests
EUR 583

Rat Troponin T Type 1, Slow Skeletal (TNNT1) ELISA Kit

RDR-TNNT1-Ra-96Tests 96 Tests
EUR 811

Human Troponin T Type 1, Slow Skeletal (TNNT1) ELISA Kit

RD-TNNT1-Hu-48Tests 48 Tests
EUR 521

Human Troponin T Type 1, Slow Skeletal (TNNT1) ELISA Kit

RD-TNNT1-Hu-96Tests 96 Tests
EUR 723

Mouse Troponin T Type 1, Slow Skeletal (TNNT1) ELISA Kit

RD-TNNT1-Mu-48Tests 48 Tests
EUR 533

Mouse Troponin T Type 1, Slow Skeletal (TNNT1) ELISA Kit

RD-TNNT1-Mu-96Tests 96 Tests
EUR 740

Rat Troponin T Type 1, Slow Skeletal (TNNT1) ELISA Kit

RD-TNNT1-Ra-48Tests 48 Tests
EUR 557

Rat Troponin T Type 1, Slow Skeletal (TNNT1) ELISA Kit

RD-TNNT1-Ra-96Tests 96 Tests
EUR 775

TNNT1 Conjugated Antibody

C46287 100ul
EUR 397

anti- TNNT1 antibody

FNab08841 100µg
EUR 548.75
  • Immunogen: troponin T type 1(skeletal, slow)
  • Uniprot ID: P13805
  • Gene ID: 7138
  • Research Area: Neuroscience, Stem Cells, Cardiovascular
Description: Antibody raised against TNNT1

Anti-TNNT1 antibody

PAab08841 100 ug
EUR 386

Anti-TNNT1 antibody

STJ112391 100 µl
EUR 277
Description: This gene encodes a protein that is a subunit of troponin, which is a regulatory complex located on the thin filament of the sarcomere. This complex regulates striated muscle contraction in response to fluctuations in intracellular calcium concentration. This complex is composed of three subunits: troponin C, which binds calcium, troponin T, which binds tropomyosin, and troponin I, which is an inhibitory subunit. This protein is the slow skeletal troponin T subunit. Mutations in this gene cause nemaline myopathy type 5, also known as Amish nemaline myopathy, a neuromuscular disorder characterized by muscle weakness and rod-shaped, or nemaline, inclusions in skeletal muscle fibers which affects infants, resulting in death due to respiratory insufficiency, usually in the second year. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-TNNT1 antibody

STJ72946 100 µg
EUR 359

Anti-TNNT1 antibody

STJ191558 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TNNT1

Tnnt1/ Rat Tnnt1 ELISA Kit

ELI-05871r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TNNT1 Blocking Peptide

DF9976-BP 1mg
EUR 195

TNNT1 cloning plasmid

CSB-CL024015HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 789
  • Sequence: atgtcggacaccgaggagcaggaatatgaggaggagcagccggaagaggaggctgcggaggaggaggaggaagcccccgaagagccggagccggtggcagagccagaagaggaacgccccaaaccaagccgccccgtggtgcctcctttgatcccgccaaagatcccagaagggga
  • Show more
Description: A cloning plasmid for the TNNT1 gene.

Troponin T Type 1, Slow Skeletal (TNNT1) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT1 (Met1~Lys261)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Troponin T Type 1, Slow Skeletal (TNNT1)


ELA-E1820h 96 Tests
EUR 824


EF006056 96 Tests
EUR 689

Rat TNNT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse TNNT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TNNT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TNNT1 Recombinant Protein (Rat)

RP234158 100 ug Ask for price

TNNT1 Recombinant Protein (Human)

RP032497 100 ug Ask for price

TNNT1 Recombinant Protein (Mouse)

RP180377 100 ug Ask for price

Rabbit Troponin T, Slow Skeletal Muscle (TNNT1) ELISA Kit

abx362125-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Troponin T Type 1, Slow Skeletal (TNNT1) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT1 (Met1~Lys261)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Troponin T Type 1, Slow Skeletal (TNNT1). This antibody is labeled with APC.

Troponin T Type 1, Slow Skeletal (TNNT1) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT1 (Met1~Lys261)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Troponin T Type 1, Slow Skeletal (TNNT1). This antibody is labeled with Biotin.

Troponin T Type 1, Slow Skeletal (TNNT1) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT1 (Met1~Lys261)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Troponin T Type 1, Slow Skeletal (TNNT1). This antibody is labeled with Cy3.

Troponin T Type 1, Slow Skeletal (TNNT1) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT1 (Met1~Lys261)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Troponin T Type 1, Slow Skeletal (TNNT1). This antibody is labeled with FITC.

Troponin T Type 1, Slow Skeletal (TNNT1) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT1 (Met1~Lys261)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Troponin T Type 1, Slow Skeletal (TNNT1). This antibody is labeled with HRP.

Troponin T Type 1, Slow Skeletal (TNNT1) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT1 (Met1~Lys261)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Troponin T Type 1, Slow Skeletal (TNNT1). This antibody is labeled with PE.

Troponin T Type 1, Slow Skeletal (TNNT1) Polyclonal Antibody (Mouse, Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT1 (Met1~Lys228)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Troponin T Type 1, Slow Skeletal (TNNT1)

Slow Skeletal Muscle Troponin T (TNNT1) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Troponin T, Slow Skeletal Muscle (TNNT1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Slow Skeletal Muscle Troponin T (TNNT1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Slow Skeletal Muscle Troponin T (TNNT1) Antibody

abx238841-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Slow Skeletal Muscle Troponin T (TNNT1) Antibody

abx433390-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Tnnt1 ORF Vector (Rat) (pORF)

ORF078054 1.0 ug DNA
EUR 506

TNNT1 ORF Vector (Human) (pORF)

ORF010833 1.0 ug DNA
EUR 95

Tnnt1 ORF Vector (Mouse) (pORF)

ORF060127 1.0 ug DNA
EUR 506

TNNT1 ELISA Kit (Mouse) (OKAN05146)

OKAN05146 96 Wells
EUR 792
Description: Description of target: This gene encodes the slow skeletal tropomyosin-binding subunit of the troponin complex and plays an essential role in the regulation of striated muscle contraction. In humans, mutations in this gene are associated with nemaline myopathy type 5. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.8 pg/mL

TNNT1 ELISA Kit (Human) (OKAN06065)

OKAN06065 96 Wells
EUR 792
Description: Description of target: This gene encodes a protein that is a subunit of troponin, which is a regulatory complex located on the thin filament of the sarcomere. This complex regulates striated muscle contraction in response to fluctuations in intracellular calcium concentration. This complex is composed of three subunits: troponin C, which binds calcium, troponin T, which binds tropomyosin, and troponin I, which is an inhibitory subunit. This protein is the slow skeletal troponin T subunit. Mutations in this gene cause nemaline myopathy type 5, also known as Amish nemaline myopathy, a neuromuscular disorder characterized by muscle weakness and rod-shaped, or nemaline, inclusions in skeletal muscle fibers which affects infants, resulting in death due to respiratory insufficiency, usually in the second year. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.5 pg/mL

TNNT1 ELISA Kit (Pig) (OKCA02519)

OKCA02519 96 Wells
EUR 930
Description: Description of target: Troponin T is the tropomyosin-binding subunit of troponin, the thin filament regulatory complex which confers calcium-sensitivity to striated muscle actomyosin ATPase activity. ;Species reactivity: Pig;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 7.8 pg/mL

TNNT1 ELISA Kit (Human) (OKCD08426)

OKCD08426 96 Wells
EUR 975
Description: Description of target: TNNT1 is a protein that is a subunit of troponin, which is a regulatory complex located on the thin filament of the sarcomere. This complex regulates striated muscle contraction in response to fluctuations in intracellular calcium concentration. This complex is composed of three subunits: troponin C, which binds calcium, troponin T, which binds tropomyosin, and troponin I, which is an inhibitory subunit. This protein is the slow skeletal troponin T subunit. Mutations in this gene cause nemaline myopathy type 5, also known as Amish nemaline myopathy, a neuromuscular disorder characterized by muscle weakness and rod-shaped, or nemaline, inclusions in skeletal muscle fibers which affects infants, resulting in death due to respiratory insufficiency, usually in the second year.This gene encodes a protein that is a subunit of troponin, which is a regulatory complex located on the thin filament of the sarcomere. This complex regulates striated muscle contraction in response to fluctuations in intracellular calcium concentration. This complex is composed of three subunits: troponin C, which binds calcium, troponin T, which binds tropomyosin, and troponin I, which is an inhibitory subunit. This protein is the slow skeletal troponin T subunit. Mutations in this gene cause nemaline myopathy type 5, also known as Amish nemaline myopathy, a neuromuscular disorder characterized by muscle weakness and rod-shaped, or nemaline, inclusions in skeletal muscle fibers which affects infants, resulting in death due to respiratory insufficiency, usually in the second year. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 5.5pg/mL

TNNT1 ELISA Kit (Mouse) (OKCD08427)

OKCD08427 96 Wells
EUR 1001
Description: Description of target: This gene encodes the slow skeletal tropomyosin-binding subunit of the troponin complex and plays an essential role in the regulation of striated muscle contraction. In humans, mutations in this gene are associated with nemaline myopathy type 5. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 5.8pg/mL

TNNT1 ELISA Kit (Rat) (OKCD08428)

OKCD08428 96 Wells
EUR 1053
Description: Description of target: human homolog plays a role in the calcium sensitivity of contraction in skeletal muscle.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 5.2pg/mL

TNNT1 ELISA Kit (Human) (OKEH01298)

OKEH01298 96 Wells
EUR 662
Description: Description of target: This gene encodes a protein that is a subunit of troponin, which is a regulatory complex located on the thin filament of the sarcomere. This complex regulates striated muscle contraction in response to fluctuations in intracellular calcium concentration. This complex is composed of three subunits: troponin C, which binds calcium, troponin T, which binds tropomyosin, and troponin I, which is an inhibitory subunit. This protein is the slow skeletal troponin T subunit. Mutations in this gene cause nemaline myopathy type 5, also known as Amish nemaline myopathy, a neuromuscular disorder characterized by muscle weakness and rod-shaped, or nemaline, inclusions in skeletal muscle fibers which affects infants, resulting in death due to respiratory insufficiency, usually in the second year. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 8.9 pg/mL

TNNT1 ELISA Kit (Bovine) (OKEH08431)

OKEH08431 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.84pg/mL

TNNT1 ELISA Kit (Pig) (OKEH08432)

OKEH08432 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5pg/mL

Tnnt1 ELISA Kit (Mouse) (OKEH04717)

OKEH04717 96 Wells
EUR 662
Description: Description of target: This gene encodes the slow skeletal tropomyosin-binding subunit of the troponin complex and plays an essential role in the regulation of striated muscle contraction. In humans, mutations in this gene are associated with nemaline myopathy type 5. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 4.69 pg/mL

Troponin T Type 1, Slow Skeletal (TNNT1) Polyclonal Antibody (Human, Mouse, Rat)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT1 (Met1~Gly259)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Troponin T Type 1, Slow Skeletal (TNNT1)

Troponin T Type 1, Slow Skeletal (TNNT1) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT1 (Met1~Lys261)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Troponin T Type 1, Slow Skeletal (TNNT1). This antibody is labeled with APC-Cy7.

Troponin T Type 1, Slow Skeletal (TNNT1) Polyclonal Antibody (Mouse, Rat), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT1 (Met1~Lys228)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Troponin T Type 1, Slow Skeletal (TNNT1). This antibody is labeled with APC.

Troponin T Type 1, Slow Skeletal (TNNT1) Polyclonal Antibody (Mouse, Rat), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT1 (Met1~Lys228)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Troponin T Type 1, Slow Skeletal (TNNT1). This antibody is labeled with Biotin.

Troponin T Type 1, Slow Skeletal (TNNT1) Polyclonal Antibody (Mouse, Rat), Cy3

  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT1 (Met1~Lys228)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Troponin T Type 1, Slow Skeletal (TNNT1). This antibody is labeled with Cy3.

Troponin T Type 1, Slow Skeletal (TNNT1) Polyclonal Antibody (Mouse, Rat), FITC

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT1 (Met1~Lys228)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Troponin T Type 1, Slow Skeletal (TNNT1). This antibody is labeled with FITC.

Troponin T Type 1, Slow Skeletal (TNNT1) Polyclonal Antibody (Mouse, Rat), HRP

  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT1 (Met1~Lys228)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Troponin T Type 1, Slow Skeletal (TNNT1). This antibody is labeled with HRP.

Troponin T Type 1, Slow Skeletal (TNNT1) Polyclonal Antibody (Mouse, Rat), PE

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT1 (Met1~Lys228)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Troponin T Type 1, Slow Skeletal (TNNT1). This antibody is labeled with PE.

Troponin T Type 1, Slow Skeletal (TNNT1) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Troponin T Type 1, Slow Skeletal (TNNT1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Troponin T Type 1, Slow Skeletal (TNNT1) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Troponin T Type 1, Slow Skeletal (TNNT1) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Troponin T Type 1, Slow Skeletal (TNNT1) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Troponin T Type 1, Slow Skeletal (TNNT1) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Troponin T Type 1, Slow Skeletal (TNNT1) Polyclonal Antibody (Human, Mouse, Rat), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT1 (Met1~Gly259)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Troponin T Type 1, Slow Skeletal (TNNT1). This antibody is labeled with APC.

Troponin T Type 1, Slow Skeletal (TNNT1) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT1 (Met1~Gly259)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Troponin T Type 1, Slow Skeletal (TNNT1). This antibody is labeled with Biotin.

Troponin T Type 1, Slow Skeletal (TNNT1) Polyclonal Antibody (Human, Mouse, Rat), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT1 (Met1~Gly259)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Troponin T Type 1, Slow Skeletal (TNNT1). This antibody is labeled with Cy3.

Troponin T Type 1, Slow Skeletal (TNNT1) Polyclonal Antibody (Human, Mouse, Rat), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT1 (Met1~Gly259)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Troponin T Type 1, Slow Skeletal (TNNT1). This antibody is labeled with FITC.

Troponin T Type 1, Slow Skeletal (TNNT1) Polyclonal Antibody (Human, Mouse, Rat), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT1 (Met1~Gly259)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Troponin T Type 1, Slow Skeletal (TNNT1). This antibody is labeled with HRP.

Troponin T Type 1, Slow Skeletal (TNNT1) Polyclonal Antibody (Human, Mouse, Rat), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT1 (Met1~Gly259)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Troponin T Type 1, Slow Skeletal (TNNT1). This antibody is labeled with PE.

Troponin T Type 1, Slow Skeletal (TNNT1) Polyclonal Antibody (Mouse, Rat), APC-Cy7

  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT1 (Met1~Lys228)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Troponin T Type 1, Slow Skeletal (TNNT1). This antibody is labeled with APC-Cy7.

Tnnt1 sgRNA CRISPR Lentivector set (Rat)

K7029301 3 x 1.0 ug
EUR 339

Tnnt1 sgRNA CRISPR Lentivector set (Mouse)

K3404101 3 x 1.0 ug
EUR 339

TNNT1 sgRNA CRISPR Lentivector set (Human)

K2419801 3 x 1.0 ug
EUR 339

Troponin T Type 1, Slow Skeletal (TNNT1) Antibody (Biotin)

  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Troponin T Type 1, Slow Skeletal (TNNT1) Antibody (FITC)

  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Troponin T Type 1, Slow Skeletal (TNNT1) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT1 (Met1~Gly259)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Troponin T Type 1, Slow Skeletal (TNNT1). This antibody is labeled with APC-Cy7.

Tnnt1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7029302 1.0 ug DNA
EUR 154

Tnnt1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7029303 1.0 ug DNA
EUR 154

Tnnt1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7029304 1.0 ug DNA
EUR 154

Tnnt1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3404102 1.0 ug DNA
EUR 154

Tnnt1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3404103 1.0 ug DNA
EUR 154

Tnnt1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3404104 1.0 ug DNA
EUR 154

TNNT1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2419802 1.0 ug DNA
EUR 154

TNNT1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2419803 1.0 ug DNA
EUR 154

TNNT1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2419804 1.0 ug DNA
EUR 154

TNNT1 Protein Vector (Rat) (pPB-C-His)

PV312214 500 ng
EUR 603

TNNT1 Protein Vector (Rat) (pPB-N-His)

PV312215 500 ng
EUR 603

TNNT1 Protein Vector (Rat) (pPM-C-HA)

PV312216 500 ng
EUR 603

TNNT1 Protein Vector (Rat) (pPM-C-His)

PV312217 500 ng
EUR 603

TNNT1 Protein Vector (Mouse) (pPB-C-His)

PV240506 500 ng
EUR 603

TNNT1 Protein Vector (Mouse) (pPB-N-His)

PV240507 500 ng
EUR 603

TNNT1 Protein Vector (Mouse) (pPM-C-HA)

PV240508 500 ng
EUR 603

TNNT1 Protein Vector (Mouse) (pPM-C-His)

PV240509 500 ng
EUR 603

TNNT1 Protein Vector (Human) (pPB-C-His)

PV043329 500 ng
EUR 329

TNNT1 Protein Vector (Human) (pPB-N-His)

PV043330 500 ng
EUR 329

TNNT1 Protein Vector (Human) (pPM-C-HA)

PV043331 500 ng
EUR 329

TNNT1 Protein Vector (Human) (pPM-C-His)

PV043332 500 ng
EUR 329

Tnnt1 3'UTR Luciferase Stable Cell Line

TU120922 1.0 ml Ask for price

Tnnt1 3'UTR GFP Stable Cell Line

TU170922 1.0 ml Ask for price

Tnnt1 3'UTR Luciferase Stable Cell Line

TU222274 1.0 ml Ask for price

TNNT1 3'UTR GFP Stable Cell Line

TU076060 1.0 ml
EUR 1394

TNNT1 3'UTR Luciferase Stable Cell Line

TU026060 1.0 ml
EUR 1394

Tnnt1 3'UTR GFP Stable Cell Line

TU272274 1.0 ml Ask for price

TNNT1 ELISA Kit (Rat) : 96 Wells (OKEH00567)

OKEH00567 96 Wells
EUR 662
Description: Description of target: Troponin T is the tropomyosin-binding subunit of troponin, the thin filament regulatory complex which confers calcium-sensitivity to striated muscle actomyosin ATPase activity.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.96 pg/mL

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

TNNT1 Rabbit Polyclonal Antibody