TNNT3 Rabbit Polyclonal Antibody

TNNT3 Polyclonal Antibody

ES10399-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TNNT3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

TNNT3 Rabbit pAb

A15323-100ul 100 ul
EUR 308

TNNT3 Rabbit pAb

A15323-200ul 200 ul
EUR 459

TNNT3 Rabbit pAb

A15323-20ul 20 ul
EUR 183

TNNT3 Rabbit pAb

A15323-50ul 50 ul
EUR 223

Polyclonal TNNT3 Antibody (C-Term)

APG00894G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TNNT3 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal TNNT3 Antibody (C-Terminus)

APG01209G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TNNT3 (C-Terminus). This antibody is tested and proven to work in the following applications:

TNNT3 Antibody

44697-100ul 100ul
EUR 252

TNNT3 Antibody

44697-50ul 50ul
EUR 187

TNNT3 Antibody

DF2256 200ul
EUR 304
Description: TNNT3 antibody detects endogenous levels of total TNNT3.

TNNT3 Antibody

ABD2256 100 ug
EUR 438

Anti-TNNT3 Antibody

A05885-2 100ug/vial
EUR 294

TNNT3 Conjugated Antibody

C44697 100ul
EUR 397

anti- TNNT3 antibody

FNab08842 100µg
EUR 548.75
  • Immunogen: troponin T type 3(skeletal, fast)
  • Uniprot ID: P45378
  • Gene ID: 7140
  • Research Area: Neuroscience, Cardiovascular
Description: Antibody raised against TNNT3

Anti-TNNT3 antibody

PAab08842 100 ug
EUR 386

Anti-TNNT3 antibody

STJ117518 100 µl
EUR 277
Description: The binding of Ca(2+) to the trimeric troponin complex initiates the process of muscle contraction. Increased Ca(2+) concentrations produce a conformational change in the troponin complex that is transmitted to tropomyosin dimers situated along actin filaments. The altered conformation permits increased interaction between a myosin head and an actin filament which, ultimately, produces a muscle contraction. The troponin complex has protein subunits C, I, and T. Subunit C binds Ca(2+) and subunit I binds to actin and inhibits actin-myosin interaction. Subunit T binds the troponin complex to the tropomyosin complex and is also required for Ca(2+)-mediated activation of actomyosin ATPase activity. There are 3 different troponin T genes that encode tissue-specific isoforms of subunit T for fast skeletal-, slow skeletal-, and cardiac-muscle. This gene encodes fast skeletal troponin T protein; also known as troponin T type 3. Alternative splicing results in multiple transcript variants encoding additional distinct troponin T type 3 isoforms. A developmentally regulated switch between fetal/neonatal and adult troponin T type 3 isoforms occurs. Additional splice variants have been described but their biological validity has not been established. Mutations in this gene may cause distal arthrogryposis multiplex congenita type 2B (DA2B).

Anti-TNNT3 antibody

STJ72982 100 µg
EUR 359

Anti-TNNT3 antibody

STJ191557 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TNNT3

Tnnt3/ Rat Tnnt3 ELISA Kit

ELI-05463r 96 Tests
EUR 657

TNNT3 siRNA

20-abx905720
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TNNT3 siRNA

20-abx937682
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TNNT3 siRNA

20-abx937683
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-TNNT3

YF-PA15081 50 ul
EUR 363
Description: Mouse polyclonal to TNNT3

anti-TNNT3

YF-PA24874 50 ul
EUR 334
Description: Mouse polyclonal to TNNT3

anti-TNNT3

YF-PA27388 50 ug
EUR 363
Description: Mouse polyclonal to TNNT3

Anti-TNNT3, Biotinylated antibody

STJ73531 100 µg
EUR 359

TNNT3 Blocking Peptide

DF2256-BP 1mg
EUR 195

TNNT3 cloning plasmid

CSB-CL024017HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 753
  • Sequence: atgtctgacgaggaagttgaacaggtggaggagcagtacgaagaagaagaggaagcccaggaggaagaggaagttcaagaagaggagaaaccgagacccaaactcactgctcctaagatcccagaaggggagaaagtggacttcgatgacatccagaagaagcgtcagaacaaaga
  • Show more
Description: A cloning plasmid for the TNNT3 gene.

Recombinant bovine TNNT3

P1041 100ug Ask for price
  • Uniprot ID: Q8MKI3
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for bovine TNNT3

Anti-TNNT3 (1F12)

YF-MA15919 100 ug
EUR 363
Description: Mouse monoclonal to TNNT3

Anti-TNNT3 (1H4)

YF-MA15920 200 ul
EUR 363
Description: Mouse monoclonal to TNNT3

Troponin T Type 3, Fast Skeletal (TNNT3) Polyclonal Antibody (Human)

4-PAD233Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT3 (Arg147~Lys269)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Troponin T Type 3, Fast Skeletal (TNNT3)

Human TNNT3 ELISA Kit

ELA-E1669h 96 Tests
EUR 824

Chicken TNNT3 ELISA KIT

ELI-05464c 96 Tests
EUR 928

TNNT3 ELISA KIT|Human

EF005998 96 Tests
EUR 689

Mouse TNNT3 shRNA Plasmid

20-abx973178
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat TNNT3 shRNA Plasmid

20-abx984669
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TNNT3 shRNA Plasmid

20-abx954899
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TNNT3 Recombinant Protein (Rat)

RP234164 100 ug Ask for price

TNNT3 Recombinant Protein (Human)

RP044374 100 ug Ask for price

TNNT3 Recombinant Protein (Mouse)

RP180410 100 ug Ask for price

TNNT3 Recombinant Protein (Mouse)

RP180413 100 ug Ask for price

TNNT3 Recombinant Protein (Mouse)

RP180416 100 ug Ask for price

TNNT3 Recombinant Protein (Mouse)

RP180419 100 ug Ask for price

TNNT3 Recombinant Protein (Mouse)

RP180422 100 ug Ask for price

TNNT3 Recombinant Protein (Mouse)

RP180425 100 ug Ask for price

TNNT3 Recombinant Protein (Mouse)

RP180428 100 ug Ask for price

TNNT3 Recombinant Protein (Mouse)

RP180431 100 ug Ask for price

Rabbit Troponin T, fast skeletal muscle(TNNT3) ELISA kit

E04T0722-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Troponin T, fast skeletal muscle(TNNT3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Troponin T, fast skeletal muscle(TNNT3) ELISA kit

E04T0722-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Troponin T, fast skeletal muscle(TNNT3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Troponin T, fast skeletal muscle(TNNT3) ELISA kit

E04T0722-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Troponin T, fast skeletal muscle(TNNT3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Troponin T, fast skeletal muscle, TNNT3 ELISA KIT

ELI-05461Ra 96 Tests
EUR 928

Troponin T Type 3, Fast Skeletal (TNNT3) Polyclonal Antibody (Human), APC

4-PAD233Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT3 (Arg147~Lys269)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Troponin T Type 3, Fast Skeletal (TNNT3). This antibody is labeled with APC.

Troponin T Type 3, Fast Skeletal (TNNT3) Polyclonal Antibody (Human), Biotinylated

4-PAD233Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT3 (Arg147~Lys269)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Troponin T Type 3, Fast Skeletal (TNNT3). This antibody is labeled with Biotin.

Troponin T Type 3, Fast Skeletal (TNNT3) Polyclonal Antibody (Human), Cy3

4-PAD233Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT3 (Arg147~Lys269)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Troponin T Type 3, Fast Skeletal (TNNT3). This antibody is labeled with Cy3.

Troponin T Type 3, Fast Skeletal (TNNT3) Polyclonal Antibody (Human), FITC

4-PAD233Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT3 (Arg147~Lys269)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Troponin T Type 3, Fast Skeletal (TNNT3). This antibody is labeled with FITC.

Troponin T Type 3, Fast Skeletal (TNNT3) Polyclonal Antibody (Human), HRP

4-PAD233Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT3 (Arg147~Lys269)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Troponin T Type 3, Fast Skeletal (TNNT3). This antibody is labeled with HRP.

Troponin T Type 3, Fast Skeletal (TNNT3) Polyclonal Antibody (Human), PE

4-PAD233Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT3 (Arg147~Lys269)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Troponin T Type 3, Fast Skeletal (TNNT3). This antibody is labeled with PE.

Fast Skeletal Muscle Troponin T (TNNT3) Antibody

20-abx219481
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fast Skeletal Muscle Troponin T (TNNT3) Antibody

abx029224-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Fast Skeletal Muscle Troponin T (TNNT3) Antibody

abx029224-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Fast Skeletal Muscle Troponin T (TNNT3) Antibody

abx238842-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Fast Skeletal Muscle Troponin T (TNNT3) Antibody

abx431679-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Monoclonal TNNT3 Antibody (monoclonal) (M02), Clone: 1F12

AMM04224G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human TNNT3 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 1F12. This antibody is applicable in WB, E

ELISA kit for Rabbit Troponin T, fast skeletal muscle (TNNT3)

KTE90007-48T 48T
EUR 354
  • Subunit T binds the troponin complex to the tropomyosin complex and is also required for Ca(2+)-mediated activation of actomyosin ATPase activity. There are 3 different troponin T genes that encode tissue-specific isoforms of subunit T for fast skele
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Troponin T, fast skeletal muscle (TNNT3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Troponin T, fast skeletal muscle (TNNT3)

KTE90007-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Subunit T binds the troponin complex to the tropomyosin complex and is also required for Ca(2+)-mediated activation of actomyosin ATPase activity. There are 3 different troponin T genes that encode tissue-specific isoforms of subunit T for fast skele
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Troponin T, fast skeletal muscle (TNNT3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Troponin T, fast skeletal muscle (TNNT3)

KTE90007-96T 96T
EUR 572
  • Subunit T binds the troponin complex to the tropomyosin complex and is also required for Ca(2+)-mediated activation of actomyosin ATPase activity. There are 3 different troponin T genes that encode tissue-specific isoforms of subunit T for fast skele
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Troponin T, fast skeletal muscle (TNNT3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Tnnt3 ORF Vector (Rat) (pORF)

ORF078056 1.0 ug DNA
EUR 506

TNNT3 ORF Vector (Human) (pORF)

ORF014792 1.0 ug DNA
EUR 354

Tnnt3 ORF Vector (Mouse) (pORF)

ORF060138 1.0 ug DNA
EUR 506

Tnnt3 ORF Vector (Mouse) (pORF)

ORF060139 1.0 ug DNA
EUR 506

Tnnt3 ORF Vector (Mouse) (pORF)

ORF060140 1.0 ug DNA
EUR 506

Tnnt3 ORF Vector (Mouse) (pORF)

ORF060141 1.0 ug DNA
EUR 506

Tnnt3 ORF Vector (Mouse) (pORF)

ORF060142 1.0 ug DNA
EUR 506

Tnnt3 ORF Vector (Mouse) (pORF)

ORF060143 1.0 ug DNA
EUR 506

Tnnt3 ORF Vector (Mouse) (pORF)

ORF060144 1.0 ug DNA
EUR 506

Tnnt3 ORF Vector (Mouse) (pORF)

ORF060145 1.0 ug DNA
EUR 506

Troponin T Type 3, Fast Skeletal (TNNT3) Polyclonal Antibody (Human), APC-Cy7

4-PAD233Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNT3 (Arg147~Lys269)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Troponin T Type 3, Fast Skeletal (TNNT3). This antibody is labeled with APC-Cy7.

Troponin T Type 3, Fast Skeletal (TNNT3) Antibody

20-abx103554
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Troponin T Type 3, Fast Skeletal (TNNT3) Antibody

20-abx174949
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Fast Skeletal Muscle Troponin T (TNNT3) Antibody (Biotin)

abx433391-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Tnnt3 sgRNA CRISPR Lentivector set (Rat)

K7533001 3 x 1.0 ug
EUR 339

Tnnt3 sgRNA CRISPR Lentivector set (Mouse)

K3912101 3 x 1.0 ug
EUR 339

TNNT3 sgRNA CRISPR Lentivector set (Human)

K2420001 3 x 1.0 ug
EUR 339

Troponin T Type 3, Fast Skeletal (TNNT3) Antibody (Biotin)

20-abx272499
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Monoclonal TNNT3 Antibody (clone T1/61), Clone: T1/61

AMM01835G 0.05mg
EUR 484
Description: A Monoclonal antibody against Human TNNT3 (clone T1/61). The antibodies are raised in Mouse and are from clone T1/61. This antibody is applicable in WB and IHC-P, E, IHC-Fr

Bovine Troponin T, fast skeletal muscle (Tnnt3)

1-CSB-EP853993BO
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 39.0 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Bovine Troponin T, fast skeletal muscle(Tnnt3) expressed in E.coli

Bovine Troponin T, fast skeletal muscle (Tnnt3)

1-CSB-BP853993BO
  • EUR 840.00
  • EUR 332.00
  • EUR 2170.00
  • EUR 1135.00
  • EUR 1579.00
  • EUR 470.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 36.0 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Bovine Troponin T, fast skeletal muscle(Tnnt3) expressed in Baculovirus

Tnnt3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7533002 1.0 ug DNA
EUR 154

Tnnt3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7533003 1.0 ug DNA
EUR 154

Tnnt3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7533004 1.0 ug DNA
EUR 154

Tnnt3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3912102 1.0 ug DNA
EUR 154

Tnnt3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3912103 1.0 ug DNA
EUR 154

Tnnt3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3912104 1.0 ug DNA
EUR 154

TNNT3 sgRNA CRISPR Lentivector (Human) (Target 1)

K2420002 1.0 ug DNA
EUR 154

TNNT3 sgRNA CRISPR Lentivector (Human) (Target 2)

K2420003 1.0 ug DNA
EUR 154

TNNT3 sgRNA CRISPR Lentivector (Human) (Target 3)

K2420004 1.0 ug DNA
EUR 154

TNNT3 Protein Vector (Rat) (pPB-C-His)

PV312222 500 ng
EUR 603

TNNT3 Protein Vector (Rat) (pPB-N-His)

PV312223 500 ng
EUR 603

TNNT3 Protein Vector (Rat) (pPM-C-HA)

PV312224 500 ng
EUR 603

TNNT3 Protein Vector (Rat) (pPM-C-His)

PV312225 500 ng
EUR 603

TNNT3 Protein Vector (Human) (pPB-C-His)

PV059165 500 ng
EUR 481

TNNT3 Protein Vector (Human) (pPB-N-His)

PV059166 500 ng
EUR 481

TNNT3 Protein Vector (Human) (pPM-C-HA)

PV059167 500 ng
EUR 481

TNNT3 Protein Vector (Human) (pPM-C-His)

PV059168 500 ng
EUR 481

TNNT3 Protein Vector (Mouse) (pPB-C-His)

PV240550 500 ng
EUR 603

TNNT3 Protein Vector (Mouse) (pPB-N-His)

PV240551 500 ng
EUR 603

TNNT3 Protein Vector (Mouse) (pPM-C-HA)

PV240552 500 ng
EUR 603

TNNT3 Protein Vector (Mouse) (pPM-C-His)

PV240553 500 ng
EUR 603

TNNT3 Protein Vector (Mouse) (pPB-C-His)

PV240554 500 ng
EUR 603

TNNT3 Protein Vector (Mouse) (pPB-N-His)

PV240555 500 ng
EUR 603

TNNT3 Protein Vector (Mouse) (pPM-C-HA)

PV240556 500 ng
EUR 603

TNNT3 Protein Vector (Mouse) (pPM-C-His)

PV240557 500 ng
EUR 603

TNNT3 Protein Vector (Mouse) (pPB-C-His)

PV240558 500 ng
EUR 603

TNNT3 Protein Vector (Mouse) (pPB-N-His)

PV240559 500 ng
EUR 603

TNNT3 Protein Vector (Mouse) (pPM-C-HA)

PV240560 500 ng
EUR 603

TNNT3 Protein Vector (Mouse) (pPM-C-His)

PV240561 500 ng
EUR 603

TNNT3 Protein Vector (Mouse) (pPB-C-His)

PV240562 500 ng
EUR 603

TNNT3 Protein Vector (Mouse) (pPB-N-His)

PV240563 500 ng
EUR 603

TNNT3 Protein Vector (Mouse) (pPM-C-HA)

PV240564 500 ng
EUR 603

TNNT3 Protein Vector (Mouse) (pPM-C-His)

PV240565 500 ng
EUR 603

TNNT3 Protein Vector (Mouse) (pPB-C-His)

PV240566 500 ng
EUR 603

TNNT3 Protein Vector (Mouse) (pPB-N-His)

PV240567 500 ng
EUR 603

TNNT3 Protein Vector (Mouse) (pPM-C-HA)

PV240568 500 ng
EUR 603

TNNT3 Protein Vector (Mouse) (pPM-C-His)

PV240569 500 ng
EUR 603

TNNT3 Protein Vector (Mouse) (pPB-C-His)

PV240570 500 ng
EUR 603

TNNT3 Protein Vector (Mouse) (pPB-N-His)

PV240571 500 ng
EUR 603

TNNT3 Protein Vector (Mouse) (pPM-C-HA)

PV240572 500 ng
EUR 603

TNNT3 Protein Vector (Mouse) (pPM-C-His)

PV240573 500 ng
EUR 603

TNNT3 Protein Vector (Mouse) (pPB-C-His)

PV240574 500 ng
EUR 603

TNNT3 Protein Vector (Mouse) (pPB-N-His)

PV240575 500 ng
EUR 603

TNNT3 Protein Vector (Mouse) (pPM-C-HA)

PV240576 500 ng
EUR 603

TNNT3 Protein Vector (Mouse) (pPM-C-His)

PV240577 500 ng
EUR 603

TNNT3 Protein Vector (Mouse) (pPB-C-His)

PV240578 500 ng
EUR 603

TNNT3 Protein Vector (Mouse) (pPB-N-His)

PV240579 500 ng
EUR 603

TNNT3 Protein Vector (Mouse) (pPM-C-HA)

PV240580 500 ng
EUR 603

TNNT3 Protein Vector (Mouse) (pPM-C-His)

PV240581 500 ng
EUR 603

Tnnt3 3'UTR Luciferase Stable Cell Line

TU120924 1.0 ml Ask for price

Tnnt3 3'UTR GFP Stable Cell Line

TU170924 1.0 ml Ask for price

Tnnt3 3'UTR Luciferase Stable Cell Line

TU222276 1.0 ml Ask for price

TNNT3 3'UTR GFP Stable Cell Line

TU076062 1.0 ml
EUR 1394

TNNT3 3'UTR Luciferase Stable Cell Line

TU026062 1.0 ml
EUR 1394

Tnnt3 3'UTR GFP Stable Cell Line

TU272276 1.0 ml Ask for price

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

TNNT3 Rabbit Polyclonal Antibody