TNNT3 Polyclonal Antibody |
ABP60722-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human TNNT3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of TNNT3 from Human. This TNNT3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TNNT3 protein |
TNNT3 Rabbit pAb |
A15323-100ul |
Abclonal |
100 ul |
EUR 308 |
TNNT3 Rabbit pAb |
A15323-200ul |
Abclonal |
200 ul |
EUR 459 |
TNNT3 Rabbit pAb |
A15323-20ul |
Abclonal |
20 ul |
EUR 183 |
TNNT3 Rabbit pAb |
A15323-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal TNNT3 Antibody (C-Term) |
APG00894G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TNNT3 (C-Term). This antibody is tested and proven to work in the following applications: |
Polyclonal TNNT3 Antibody (C-Terminus) |
APG01209G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TNNT3 (C-Terminus). This antibody is tested and proven to work in the following applications: |
TNNT3 Antibody |
44697-100ul |
SAB |
100ul |
EUR 252 |
TNNT3 Antibody |
44697-50ul |
SAB |
50ul |
EUR 187 |
TNNT3 Antibody |
DF2256 |
Affbiotech |
200ul |
EUR 304 |
Description: TNNT3 antibody detects endogenous levels of total TNNT3. |
TNNT3 Conjugated Antibody |
C44697 |
SAB |
100ul |
EUR 397 |
anti- TNNT3 antibody |
FNab08842 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: troponin T type 3(skeletal, fast)
- Uniprot ID: P45378
- Gene ID: 7140
- Research Area: Neuroscience, Cardiovascular
|
Description: Antibody raised against TNNT3 |
Anti-TNNT3 Antibody |
A05885-2 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-TNNT3 antibody |
STJ117518 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The binding of Ca(2+) to the trimeric troponin complex initiates the process of muscle contraction. Increased Ca(2+) concentrations produce a conformational change in the troponin complex that is transmitted to tropomyosin dimers situated along actin filaments. The altered conformation permits increased interaction between a myosin head and an actin filament which, ultimately, produces a muscle contraction. The troponin complex has protein subunits C, I, and T. Subunit C binds Ca(2+) and subunit I binds to actin and inhibits actin-myosin interaction. Subunit T binds the troponin complex to the tropomyosin complex and is also required for Ca(2+)-mediated activation of actomyosin ATPase activity. There are 3 different troponin T genes that encode tissue-specific isoforms of subunit T for fast skeletal-, slow skeletal-, and cardiac-muscle. This gene encodes fast skeletal troponin T protein; also known as troponin T type 3. Alternative splicing results in multiple transcript variants encoding additional distinct troponin T type 3 isoforms. A developmentally regulated switch between fetal/neonatal and adult troponin T type 3 isoforms occurs. Additional splice variants have been described but their biological validity has not been established. Mutations in this gene may cause distal arthrogryposis multiplex congenita type 2B (DA2B). |
Anti-TNNT3 antibody |
STJ191557 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to TNNT3 |
TNNT3 siRNA |
20-abx905720 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TNNT3 siRNA |
20-abx937682 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TNNT3 siRNA |
20-abx937683 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-TNNT3 |
YF-PA15081 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to TNNT3 |
anti-TNNT3 |
YF-PA24874 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to TNNT3 |
anti-TNNT3 |
YF-PA27388 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to TNNT3 |
TNNT3 cloning plasmid |
CSB-CL024017HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 753
- Sequence: atgtctgacgaggaagttgaacaggtggaggagcagtacgaagaagaagaggaagcccaggaggaagaggaagttcaagaagaggagaaaccgagacccaaactcactgctcctaagatcccagaaggggagaaagtggacttcgatgacatccagaagaagcgtcagaacaaaga
- Show more
|
Description: A cloning plasmid for the TNNT3 gene. |
TNNT3 Blocking Peptide |
DF2256-BP |
Affbiotech |
1mg |
EUR 195 |
Recombinant bovine TNNT3 |
P1041 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: Q8MKI3
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for bovine TNNT3 |
Anti-TNNT3 (1F12) |
YF-MA15919 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to TNNT3 |
Anti-TNNT3 (1H4) |
YF-MA15920 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to TNNT3 |
Troponin T Type 3, Fast Skeletal (TNNT3) Polyclonal Antibody (Human) |
4-PAD233Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNT3 (Arg147~Lys269)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Troponin T Type 3, Fast Skeletal (TNNT3) |
Rat TNNT3 shRNA Plasmid |
20-abx984669 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human TNNT3 shRNA Plasmid |
20-abx954899 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse TNNT3 shRNA Plasmid |
20-abx973178 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
TNNT3 Recombinant Protein (Human) |
RP044374 |
ABM |
100 ug |
Ask for price |
TNNT3 Recombinant Protein (Rat) |
RP234164 |
ABM |
100 ug |
Ask for price |
TNNT3 Recombinant Protein (Mouse) |
RP180410 |
ABM |
100 ug |
Ask for price |
TNNT3 Recombinant Protein (Mouse) |
RP180413 |
ABM |
100 ug |
Ask for price |
TNNT3 Recombinant Protein (Mouse) |
RP180416 |
ABM |
100 ug |
Ask for price |
TNNT3 Recombinant Protein (Mouse) |
RP180419 |
ABM |
100 ug |
Ask for price |
TNNT3 Recombinant Protein (Mouse) |
RP180422 |
ABM |
100 ug |
Ask for price |
TNNT3 Recombinant Protein (Mouse) |
RP180425 |
ABM |
100 ug |
Ask for price |
TNNT3 Recombinant Protein (Mouse) |
RP180428 |
ABM |
100 ug |
Ask for price |
TNNT3 Recombinant Protein (Mouse) |
RP180431 |
ABM |
100 ug |
Ask for price |
Rabbit Troponin T, fast skeletal muscle(TNNT3) ELISA kit |
E04T0722-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Troponin T, fast skeletal muscle(TNNT3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Troponin T, fast skeletal muscle(TNNT3) ELISA kit |
E04T0722-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Troponin T, fast skeletal muscle(TNNT3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Troponin T, fast skeletal muscle(TNNT3) ELISA kit |
E04T0722-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Troponin T, fast skeletal muscle(TNNT3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Troponin T, fast skeletal muscle, TNNT3 ELISA KIT |
ELI-05461Ra |
Lifescience Market |
96 Tests |
EUR 928 |
Troponin T Type 3, Fast Skeletal (TNNT3) Polyclonal Antibody (Human), APC |
4-PAD233Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNT3 (Arg147~Lys269)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Troponin T Type 3, Fast Skeletal (TNNT3). This antibody is labeled with APC. |
Troponin T Type 3, Fast Skeletal (TNNT3) Polyclonal Antibody (Human), Biotinylated |
4-PAD233Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNT3 (Arg147~Lys269)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Troponin T Type 3, Fast Skeletal (TNNT3). This antibody is labeled with Biotin. |
Troponin T Type 3, Fast Skeletal (TNNT3) Polyclonal Antibody (Human), Cy3 |
4-PAD233Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNT3 (Arg147~Lys269)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Troponin T Type 3, Fast Skeletal (TNNT3). This antibody is labeled with Cy3. |
Troponin T Type 3, Fast Skeletal (TNNT3) Polyclonal Antibody (Human), FITC |
4-PAD233Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNT3 (Arg147~Lys269)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Troponin T Type 3, Fast Skeletal (TNNT3). This antibody is labeled with FITC. |
Troponin T Type 3, Fast Skeletal (TNNT3) Polyclonal Antibody (Human), HRP |
4-PAD233Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNT3 (Arg147~Lys269)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Troponin T Type 3, Fast Skeletal (TNNT3). This antibody is labeled with HRP. |
Troponin T Type 3, Fast Skeletal (TNNT3) Polyclonal Antibody (Human), PE |
4-PAD233Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNT3 (Arg147~Lys269)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Troponin T Type 3, Fast Skeletal (TNNT3). This antibody is labeled with PE. |
Monoclonal TNNT3 Antibody (monoclonal) (M02), Clone: 1F12 |
AMM04224G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human TNNT3 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 1F12. This antibody is applicable in WB, E |
Fast Skeletal Muscle Troponin T (TNNT3) Antibody |
abx029224-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Fast Skeletal Muscle Troponin T (TNNT3) Antibody |
abx029224-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Fast Skeletal Muscle Troponin T (TNNT3) Antibody |
20-abx219481 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fast Skeletal Muscle Troponin T (TNNT3) Antibody |
abx431679-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Fast Skeletal Muscle Troponin T (TNNT3) Antibody |
abx238842-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
ELISA kit for Rabbit Troponin T, fast skeletal muscle (TNNT3) |
KTE90007-48T |
Abbkine |
48T |
EUR 354 |
- Subunit T binds the troponin complex to the tropomyosin complex and is also required for Ca(2+)-mediated activation of actomyosin ATPase activity. There are 3 different troponin T genes that encode tissue-specific isoforms of subunit T for fast skele
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rabbit Troponin T, fast skeletal muscle (TNNT3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rabbit Troponin T, fast skeletal muscle (TNNT3) |
KTE90007-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Subunit T binds the troponin complex to the tropomyosin complex and is also required for Ca(2+)-mediated activation of actomyosin ATPase activity. There are 3 different troponin T genes that encode tissue-specific isoforms of subunit T for fast skele
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rabbit Troponin T, fast skeletal muscle (TNNT3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rabbit Troponin T, fast skeletal muscle (TNNT3) |
KTE90007-96T |
Abbkine |
96T |
EUR 572 |
- Subunit T binds the troponin complex to the tropomyosin complex and is also required for Ca(2+)-mediated activation of actomyosin ATPase activity. There are 3 different troponin T genes that encode tissue-specific isoforms of subunit T for fast skele
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rabbit Troponin T, fast skeletal muscle (TNNT3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Tnnt3 ORF Vector (Mouse) (pORF) |
ORF060138 |
ABM |
1.0 ug DNA |
EUR 506 |
Tnnt3 ORF Vector (Mouse) (pORF) |
ORF060139 |
ABM |
1.0 ug DNA |
EUR 506 |
Tnnt3 ORF Vector (Mouse) (pORF) |
ORF060140 |
ABM |
1.0 ug DNA |
EUR 506 |
Tnnt3 ORF Vector (Mouse) (pORF) |
ORF060141 |
ABM |
1.0 ug DNA |
EUR 506 |
Tnnt3 ORF Vector (Mouse) (pORF) |
ORF060142 |
ABM |
1.0 ug DNA |
EUR 506 |
Tnnt3 ORF Vector (Mouse) (pORF) |
ORF060143 |
ABM |
1.0 ug DNA |
EUR 506 |
Tnnt3 ORF Vector (Mouse) (pORF) |
ORF060144 |
ABM |
1.0 ug DNA |
EUR 506 |
Tnnt3 ORF Vector (Mouse) (pORF) |
ORF060145 |
ABM |
1.0 ug DNA |
EUR 506 |
Tnnt3 ORF Vector (Rat) (pORF) |
ORF078056 |
ABM |
1.0 ug DNA |
EUR 506 |
TNNT3 ORF Vector (Human) (pORF) |
ORF014792 |
ABM |
1.0 ug DNA |
EUR 354 |
TNNT3 ELISA Kit (Human) (OKCD08432) |
OKCD08432 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: Troponin T is the tropomyosin-binding subunit of troponin, the thin filament regulatory complex which confers calcium-sensitivity to striated muscle actomyosin ATPase activity.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 5.9 pg/mL |
TNNT3 ELISA Kit (Human) (OKEH01206) |
OKEH01206 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: The binding of Ca(2+) to the trimeric troponin complex initiates the process of muscle contraction. Increased Ca(2+) concentrations produce a conformational change in the troponin complex that is transmitted to tropomyosin dimers situated along actin filaments. The altered conformation permits increased interaction between a myosin head and an actin filament which, ultimately, produces a muscle contraction. The troponin complex has protein subunits C, I, and T. Subunit C binds Ca(2+) and subunit I binds to actin and inhibits actin-myosin interaction. Subunit T binds the troponin complex to the tropomyosin complex and is also required for Ca(2+)-mediated activation of actomyosin ATPase activity. There are 3 different troponin T genes that encode tissue-specific isoforms of subunit T for fast skeletal-, slow skeletal-, and cardiac-muscle. This gene encodes fast skeletal troponin T protein; also known as troponin T type 3. Alternative splicing results in multiple transcript variants encoding additional distinct troponin T type 3 isoforms. A developmentally regulated switch between fetal/neonatal and adult troponin T type 3 isoforms occurs. Additional splice variants have been described but their biological validity has not been established. Mutations in this gene may cause distal arthrogryposis multiplex congenita type 2B (DA2B).;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.2 pg/mL |
TNNT3 ELISA Kit (Rat) (OKEH03393) |
OKEH03393 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Troponin T is the tropomyosin-binding subunit of troponin, the thin filament regulatory complex which confers calcium-sensitivity to striated muscle actomyosin ATPase activity.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.88 pg/mL |
TNNT3 ELISA Kit (Mouse) (OKEH05372) |
OKEH05372 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Troponin T is the tropomyosin-binding subunit of troponin, the thin filament regulatory complex which confers calcium-sensitivity to striated muscle actomyosin ATPase activity.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.86 pg/mL |
Tnnt3 ELISA Kit (Bovine) (OKEH08407) |
OKEH08407 |
Aviva Systems Biology |
96 Wells |
EUR 1092 |
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.5pg/mL |
Troponin T Type 3, Fast Skeletal (TNNT3) Polyclonal Antibody (Human), APC-Cy7 |
4-PAD233Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNNT3 (Arg147~Lys269)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Troponin T Type 3, Fast Skeletal (TNNT3). This antibody is labeled with APC-Cy7. |
Troponin T Type 3, Fast Skeletal (TNNT3) Antibody |
20-abx103554 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Troponin T Type 3, Fast Skeletal (TNNT3) Antibody |
20-abx174949 |
Abbexa |
|
|
|
Fast Skeletal Muscle Troponin T (TNNT3) Antibody (Biotin) |
abx433391-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
TNNT3 sgRNA CRISPR Lentivector set (Human) |
K2420001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Tnnt3 sgRNA CRISPR Lentivector set (Mouse) |
K3912101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Tnnt3 sgRNA CRISPR Lentivector set (Rat) |
K7533001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Monoclonal TNNT3 Antibody (clone T1/61), Clone: T1/61 |
AMM01835G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A Monoclonal antibody against Human TNNT3 (clone T1/61). The antibodies are raised in Mouse and are from clone T1/61. This antibody is applicable in WB and IHC-P, E, IHC-Fr |
Troponin T Type 3, Fast Skeletal (TNNT3) Antibody (Biotin) |
20-abx272499 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
TNNT3 Rabbit Polyclonal Antibody