TRPV6 Rabbit Polyclonal Antibody

TRPV6 Polyclonal Antibody

ABP60773-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TRPV6 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRPV6 from Human, Mouse, Rat. This TRPV6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRPV6 protein

TRPV6 Polyclonal Antibody

ABP60773-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TRPV6 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRPV6 from Human, Mouse, Rat. This TRPV6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRPV6 protein

TRPV6 Polyclonal Antibody

A70187 100 ?g
EUR 628.55
Description: reagents widely cited

TRPV6 Rabbit pAb

A16128-100ul 100 ul
EUR 308

TRPV6 Rabbit pAb

A16128-200ul 200 ul
EUR 459

TRPV6 Rabbit pAb

A16128-20ul 20 ul
EUR 183

TRPV6 Rabbit pAb

A16128-50ul 50 ul
EUR 223

TRPV6 Rabbit pAb

A1495-100ul 100 ul
EUR 308

TRPV6 Rabbit pAb

A1495-200ul 200 ul
EUR 459

TRPV6 Rabbit pAb

A1495-20ul 20 ul Ask for price

TRPV6 Rabbit pAb

A1495-50ul 50 ul Ask for price

Polyclonal TRPV6 Antibody (Center)

APR10546G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRPV6 (Center). This antibody is tested and proven to work in the following applications:

TRPV6 antibody

70R-21017 50 ul
EUR 435
Description: Rabbit polyclonal TRPV6 antibody

Trpv6 antibody

70R-8072 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Trpv6 antibody

TRPV6 Antibody

39563-100ul 100ul
EUR 390

TRPV6 Antibody

43287-100ul 100ul
EUR 252

TRPV6 Antibody

DF12784 200ul
EUR 304
Description: TRPV6 Antibody detects endogenous levels of TRPV6.

TRPV6 Antibody

1-CSB-PA861992LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRPV6. Recognizes TRPV6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

TRPV6 Antibody

1-CSB-PA025098GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TRPV6. Recognizes TRPV6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

TRPV6 Polyclonal Antibody, HRP Conjugated

A70188 100 ?g
EUR 628.55
Description: Ask the seller for details

TRPV6 Polyclonal Antibody, FITC Conjugated

A70189 100 ?g
EUR 628.55
Description: The best epigenetics products

TRPV6 Polyclonal Antibody, Biotin Conjugated

A70190 100 ?g
EUR 628.55
Description: kits suitable for this type of research

Trpv6/ Rat Trpv6 ELISA Kit

ELI-51853r 96 Tests
EUR 886

TRPV6 Conjugated Antibody

C43287 100ul
EUR 397

anti- TRPV6 antibody

FNab09030 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:200-1:1000
  • IF: 1:10-1:100
  • Immunogen: transient receptor potential cation channel, subfamily V, member 6
  • Uniprot ID: Q9H1D0
  • Gene ID: 55503
  • Research Area: Cancer
Description: Antibody raised against TRPV6

Anti-TRPV6 antibody

PAab09030 100 ug
EUR 386

Anti-TRPV6 Antibody

PA1980 100ug/vial
EUR 294

Anti-TRPV6 Antibody

STJ503414 100 µg
EUR 476

Anti-TRPV6 antibody

STJ25977 100 µl
EUR 277
Description: This gene encodes a member of a family of multipass membrane proteins that functions as calcium channels. The encoded protein contains N-terminal ankyrin repeats, which are required for channel assembly and regulation. Translation initiation for this protein occurs at a non-AUG start codon that is decoded as methionine. This gene is situated next to a closely related gene for transient receptor potential cation channel subfamily V member 5 (TRPV5). This locus has experienced positive selection in non-African populations, resulting in several non-synonymous codon differences among individuals of different genetic backgrounds.

Anti-TRPV6 antibody

STJ118581 100 µl
EUR 277

Anti-TRPV6 antibody

STJ191549 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TRPV6

TRPV6 siRNA

20-abx905818
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TRPV6 siRNA

20-abx938250
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TRPV6 siRNA

20-abx938251
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TRPV6 Antibody, HRP conjugated

1-CSB-PA861992LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRPV6. Recognizes TRPV6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TRPV6 Antibody, FITC conjugated

1-CSB-PA861992LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRPV6. Recognizes TRPV6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TRPV6 Antibody, Biotin conjugated

1-CSB-PA861992LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRPV6. Recognizes TRPV6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-TRPV6 Antibody BIOTIN

STJ503415 100 µg
EUR 586

Anti-TRPV6 Antibody FITC

STJ503416 100 µg
EUR 586

Trpv6 Blocking Peptide

33R-9040 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Trpv6 antibody, catalog no. 70R-8072

TRPV6 cloning plasmid

CSB-CL861992HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 321
  • Sequence: atgtacgttgagaatcactgctccaggcctgcattactccttcagctctggggcagaggaagcccagcccaagcacggggctggcagggcgtgaggaactctcctgtggcctgctcatcacccttccgacaggagcactgcatgtcagagcactttaaaaacaggccagcctgctt
  • Show more
Description: A cloning plasmid for the TRPV6 gene.

TRPV6 Blocking Peptide

DF12784-BP 1mg
EUR 195

pDONR223-TRPV6 Plasmid

PVTB00947-1 2 ug
EUR 356

Mouse TRPV6 shRNA Plasmid

20-abx975264
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat TRPV6 shRNA Plasmid

20-abx987187
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TRPV6 ELISA KIT|Human

EF003875 96 Tests
EUR 689

Mouse Trpv6 ELISA KIT

ELI-40180m 96 Tests
EUR 865

Human TRPV6 ELISA KIT

ELI-51649h 96 Tests
EUR 824

Human TRPV6 shRNA Plasmid

20-abx960711
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TRPV6 Recombinant Protein (Human)

RP033088 100 ug Ask for price

TRPV6 Recombinant Protein (Rat)

RP234905 100 ug Ask for price

TRPV6 Recombinant Protein (Mouse)

RP181610 100 ug Ask for price

pCMV-SPORT6-TRPV6 Plasmid

PVT16506 2 ug
EUR 325

Trpv6 ORF Vector (Rat) (pORF)

ORF078303 1.0 ug DNA
EUR 506

TRPV6 ORF Vector (Human) (pORF)

ORF011030 1.0 ug DNA
EUR 95

Trpv6 ORF Vector (Mouse) (pORF)

ORF060538 1.0 ug DNA
EUR 506

TRPV6 sgRNA CRISPR Lentivector set (Human)

K2537401 3 x 1.0 ug
EUR 339

Trpv6 sgRNA CRISPR Lentivector set (Mouse)

K4389801 3 x 1.0 ug
EUR 339

Trpv6 sgRNA CRISPR Lentivector set (Rat)

K7116701 3 x 1.0 ug
EUR 339

Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6) Polyclonal Antibody (Human)

4-PAF851Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRPV6 (Met578~Ile725)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6)

Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6) Polyclonal Antibody (Human), APC

4-PAF851Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRPV6 (Met578~Ile725)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6). This antibody is labeled with APC.

Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6) Polyclonal Antibody (Human), Biotinylated

4-PAF851Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRPV6 (Met578~Ile725)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6). This antibody is labeled with Biotin.

Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6) Polyclonal Antibody (Human), Cy3

4-PAF851Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRPV6 (Met578~Ile725)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6). This antibody is labeled with Cy3.

Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6) Polyclonal Antibody (Human), FITC

4-PAF851Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRPV6 (Met578~Ile725)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6). This antibody is labeled with FITC.

Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6) Polyclonal Antibody (Human), HRP

4-PAF851Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRPV6 (Met578~Ile725)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6). This antibody is labeled with HRP.

Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6) Polyclonal Antibody (Human), PE

4-PAF851Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRPV6 (Met578~Ile725)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6). This antibody is labeled with PE.

TRPV6 sgRNA CRISPR Lentivector (Human) (Target 1)

K2537402 1.0 ug DNA
EUR 154

TRPV6 sgRNA CRISPR Lentivector (Human) (Target 2)

K2537403 1.0 ug DNA
EUR 154

TRPV6 sgRNA CRISPR Lentivector (Human) (Target 3)

K2537404 1.0 ug DNA
EUR 154

Trpv6 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4389802 1.0 ug DNA
EUR 154

Trpv6 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4389803 1.0 ug DNA
EUR 154

Trpv6 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4389804 1.0 ug DNA
EUR 154

Trpv6 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7116702 1.0 ug DNA
EUR 154

Trpv6 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7116703 1.0 ug DNA
EUR 154

Trpv6 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7116704 1.0 ug DNA
EUR 154

TRPV6 Protein Vector (Human) (pPB-C-His)

PV044117 500 ng
EUR 329

TRPV6 Protein Vector (Human) (pPB-N-His)

PV044118 500 ng
EUR 329

TRPV6 Protein Vector (Human) (pPM-C-HA)

PV044119 500 ng
EUR 329

TRPV6 Protein Vector (Human) (pPM-C-His)

PV044120 500 ng
EUR 329

TRPV6 Protein Vector (Rat) (pPB-C-His)

PV313210 500 ng
EUR 1166

TRPV6 Protein Vector (Rat) (pPB-N-His)

PV313211 500 ng
EUR 1166

TRPV6 Protein Vector (Rat) (pPM-C-HA)

PV313212 500 ng
EUR 1166

TRPV6 Protein Vector (Rat) (pPM-C-His)

PV313213 500 ng
EUR 1166

TRPV6 Protein Vector (Mouse) (pPB-C-His)

PV242150 500 ng
EUR 1065

TRPV6 Protein Vector (Mouse) (pPB-N-His)

PV242151 500 ng
EUR 1065

TRPV6 Protein Vector (Mouse) (pPM-C-HA)

PV242152 500 ng
EUR 1065

TRPV6 Protein Vector (Mouse) (pPM-C-His)

PV242153 500 ng
EUR 1065

Trpv6 3'UTR GFP Stable Cell Line

TU171201 1.0 ml Ask for price

TRPV6 3'UTR GFP Stable Cell Line

TU077274 1.0 ml
EUR 1394

Trpv6 3'UTR Luciferase Stable Cell Line

TU121201 1.0 ml Ask for price

TRPV6 3'UTR Luciferase Stable Cell Line

TU027274 1.0 ml
EUR 1394

Trpv6 3'UTR Luciferase Stable Cell Line

TU222520 1.0 ml Ask for price

Trpv6 3'UTR GFP Stable Cell Line

TU272520 1.0 ml Ask for price

Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6) Polyclonal Antibody (Human), APC-Cy7

4-PAF851Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRPV6 (Met578~Ile725)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6). This antibody is labeled with APC-Cy7.

TRPV6 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV695887 1.0 ug DNA
EUR 1355

TRPV6 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV695891 1.0 ug DNA
EUR 1355

TRPV6 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV695892 1.0 ug DNA
EUR 1355

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

TRPV6 Rabbit Polyclonal Antibody