TRPV6 Polyclonal Antibody |
ABP60773-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human TRPV6 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of TRPV6 from Human, Mouse, Rat. This TRPV6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRPV6 protein |
TRPV6 Polyclonal Antibody |
ABP60773-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human TRPV6 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of TRPV6 from Human, Mouse, Rat. This TRPV6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRPV6 protein |
TRPV6 Polyclonal Antibody |
A70187 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: reagents widely cited |
TRPV6 Rabbit pAb |
A16128-100ul |
Abclonal |
100 ul |
EUR 308 |
TRPV6 Rabbit pAb |
A16128-200ul |
Abclonal |
200 ul |
EUR 459 |
TRPV6 Rabbit pAb |
A16128-20ul |
Abclonal |
20 ul |
EUR 183 |
TRPV6 Rabbit pAb |
A16128-50ul |
Abclonal |
50 ul |
EUR 223 |
TRPV6 Rabbit pAb |
A1495-100ul |
Abclonal |
100 ul |
EUR 308 |
TRPV6 Rabbit pAb |
A1495-200ul |
Abclonal |
200 ul |
EUR 459 |
TRPV6 Rabbit pAb |
A1495-20ul |
Abclonal |
20 ul |
Ask for price |
TRPV6 Rabbit pAb |
A1495-50ul |
Abclonal |
50 ul |
Ask for price |
Polyclonal TRPV6 Antibody (Center) |
APR10546G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRPV6 (Center). This antibody is tested and proven to work in the following applications: |
TRPV6 antibody |
70R-21017 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal TRPV6 antibody |
Trpv6 antibody |
70R-8072 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal Trpv6 antibody |
TRPV6 Antibody |
39563-100ul |
SAB |
100ul |
EUR 390 |
TRPV6 Antibody |
43287-100ul |
SAB |
100ul |
EUR 252 |
TRPV6 Antibody |
DF12784 |
Affbiotech |
200ul |
EUR 304 |
Description: TRPV6 Antibody detects endogenous levels of TRPV6. |
TRPV6 Antibody |
1-CSB-PA861992LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TRPV6. Recognizes TRPV6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500 |
TRPV6 Antibody |
1-CSB-PA025098GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against TRPV6. Recognizes TRPV6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF |
TRPV6 Polyclonal Antibody, HRP Conjugated |
A70188 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: Ask the seller for details |
TRPV6 Polyclonal Antibody, FITC Conjugated |
A70189 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: The best epigenetics products |
TRPV6 Polyclonal Antibody, Biotin Conjugated |
A70190 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: kits suitable for this type of research |
TRPV6 Conjugated Antibody |
C43287 |
SAB |
100ul |
EUR 397 |
anti- TRPV6 antibody |
FNab09030 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:5000
- IP: 1:200-1:1000
- IF: 1:10-1:100
- Immunogen: transient receptor potential cation channel, subfamily V, member 6
- Uniprot ID: Q9H1D0
- Gene ID: 55503
- Research Area: Cancer
|
Description: Antibody raised against TRPV6 |
Anti-TRPV6 Antibody |
PA1980 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-TRPV6 antibody |
STJ25977 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of a family of multipass membrane proteins that functions as calcium channels. The encoded protein contains N-terminal ankyrin repeats, which are required for channel assembly and regulation. Translation initiation for this protein occurs at a non-AUG start codon that is decoded as methionine. This gene is situated next to a closely related gene for transient receptor potential cation channel subfamily V member 5 (TRPV5). This locus has experienced positive selection in non-African populations, resulting in several non-synonymous codon differences among individuals of different genetic backgrounds. |
Anti-TRPV6 antibody |
STJ191549 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to TRPV6 |
TRPV6 siRNA |
20-abx905818 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TRPV6 siRNA |
20-abx938250 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TRPV6 siRNA |
20-abx938251 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TRPV6 Antibody, HRP conjugated |
1-CSB-PA861992LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TRPV6. Recognizes TRPV6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
TRPV6 Antibody, FITC conjugated |
1-CSB-PA861992LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TRPV6. Recognizes TRPV6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
TRPV6 Antibody, Biotin conjugated |
1-CSB-PA861992LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TRPV6. Recognizes TRPV6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Trpv6 Blocking Peptide |
33R-9040 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Trpv6 antibody, catalog no. 70R-8072 |
TRPV6 cloning plasmid |
CSB-CL861992HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 321
- Sequence: atgtacgttgagaatcactgctccaggcctgcattactccttcagctctggggcagaggaagcccagcccaagcacggggctggcagggcgtgaggaactctcctgtggcctgctcatcacccttccgacaggagcactgcatgtcagagcactttaaaaacaggccagcctgctt
- Show more
|
Description: A cloning plasmid for the TRPV6 gene. |
TRPV6 Blocking Peptide |
DF12784-BP |
Affbiotech |
1mg |
EUR 195 |
Mouse TRPV6 shRNA Plasmid |
20-abx975264 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat TRPV6 shRNA Plasmid |
20-abx987187 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human TRPV6 shRNA Plasmid |
20-abx960711 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
TRPV6 Recombinant Protein (Human) |
RP033088 |
ABM |
100 ug |
Ask for price |
TRPV6 Recombinant Protein (Rat) |
RP234905 |
ABM |
100 ug |
Ask for price |
TRPV6 Recombinant Protein (Mouse) |
RP181610 |
ABM |
100 ug |
Ask for price |
Trpv6 ORF Vector (Rat) (pORF) |
ORF078303 |
ABM |
1.0 ug DNA |
EUR 506 |
TRPV6 ORF Vector (Human) (pORF) |
ORF011030 |
ABM |
1.0 ug DNA |
EUR 95 |
Trpv6 ORF Vector (Mouse) (pORF) |
ORF060538 |
ABM |
1.0 ug DNA |
EUR 506 |
TRPV6 sgRNA CRISPR Lentivector set (Human) |
K2537401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Trpv6 sgRNA CRISPR Lentivector set (Mouse) |
K4389801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Trpv6 sgRNA CRISPR Lentivector set (Rat) |
K7116701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6) Polyclonal Antibody (Human) |
4-PAF851Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TRPV6 (Met578~Ile725)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6) |
Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6) Polyclonal Antibody (Human), APC |
4-PAF851Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TRPV6 (Met578~Ile725)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6). This antibody is labeled with APC. |
Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6) Polyclonal Antibody (Human), Biotinylated |
4-PAF851Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TRPV6 (Met578~Ile725)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6). This antibody is labeled with Biotin. |
Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6) Polyclonal Antibody (Human), Cy3 |
4-PAF851Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TRPV6 (Met578~Ile725)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6). This antibody is labeled with Cy3. |
Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6) Polyclonal Antibody (Human), FITC |
4-PAF851Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TRPV6 (Met578~Ile725)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6). This antibody is labeled with FITC. |
Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6) Polyclonal Antibody (Human), HRP |
4-PAF851Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TRPV6 (Met578~Ile725)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6). This antibody is labeled with HRP. |
Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6) Polyclonal Antibody (Human), PE |
4-PAF851Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TRPV6 (Met578~Ile725)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6). This antibody is labeled with PE. |
TRPV6 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2537402 |
ABM |
1.0 ug DNA |
EUR 154 |
TRPV6 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2537403 |
ABM |
1.0 ug DNA |
EUR 154 |
TRPV6 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2537404 |
ABM |
1.0 ug DNA |
EUR 154 |
Trpv6 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4389802 |
ABM |
1.0 ug DNA |
EUR 154 |
Trpv6 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4389803 |
ABM |
1.0 ug DNA |
EUR 154 |
Trpv6 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4389804 |
ABM |
1.0 ug DNA |
EUR 154 |
Trpv6 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7116702 |
ABM |
1.0 ug DNA |
EUR 154 |
Trpv6 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7116703 |
ABM |
1.0 ug DNA |
EUR 154 |
Trpv6 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7116704 |
ABM |
1.0 ug DNA |
EUR 154 |
TRPV6 Protein Vector (Human) (pPB-C-His) |
PV044117 |
ABM |
500 ng |
EUR 329 |
TRPV6 Protein Vector (Human) (pPB-N-His) |
PV044118 |
ABM |
500 ng |
EUR 329 |
TRPV6 Protein Vector (Human) (pPM-C-HA) |
PV044119 |
ABM |
500 ng |
EUR 329 |
TRPV6 Protein Vector (Human) (pPM-C-His) |
PV044120 |
ABM |
500 ng |
EUR 329 |
TRPV6 Protein Vector (Rat) (pPB-C-His) |
PV313210 |
ABM |
500 ng |
EUR 1166 |
TRPV6 Protein Vector (Rat) (pPB-N-His) |
PV313211 |
ABM |
500 ng |
EUR 1166 |
TRPV6 Protein Vector (Rat) (pPM-C-HA) |
PV313212 |
ABM |
500 ng |
EUR 1166 |
TRPV6 Protein Vector (Rat) (pPM-C-His) |
PV313213 |
ABM |
500 ng |
EUR 1166 |
TRPV6 Protein Vector (Mouse) (pPB-C-His) |
PV242150 |
ABM |
500 ng |
EUR 1065 |
TRPV6 Protein Vector (Mouse) (pPB-N-His) |
PV242151 |
ABM |
500 ng |
EUR 1065 |
TRPV6 Protein Vector (Mouse) (pPM-C-HA) |
PV242152 |
ABM |
500 ng |
EUR 1065 |
TRPV6 Protein Vector (Mouse) (pPM-C-His) |
PV242153 |
ABM |
500 ng |
EUR 1065 |
Trpv6 3'UTR GFP Stable Cell Line |
TU171201 |
ABM |
1.0 ml |
Ask for price |
TRPV6 3'UTR GFP Stable Cell Line |
TU077274 |
ABM |
1.0 ml |
EUR 1394 |
Trpv6 3'UTR Luciferase Stable Cell Line |
TU121201 |
ABM |
1.0 ml |
Ask for price |
TRPV6 3'UTR Luciferase Stable Cell Line |
TU027274 |
ABM |
1.0 ml |
EUR 1394 |
Trpv6 3'UTR Luciferase Stable Cell Line |
TU222520 |
ABM |
1.0 ml |
Ask for price |
Trpv6 3'UTR GFP Stable Cell Line |
TU272520 |
ABM |
1.0 ml |
Ask for price |
Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6) Polyclonal Antibody (Human), APC-Cy7 |
4-PAF851Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TRPV6 (Met578~Ile725)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Transient Receptor Potential Cation Channel Subfamily V, Member 6 (TRPV6). This antibody is labeled with APC-Cy7. |
TRPV6 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV695887 |
ABM |
1.0 ug DNA |
EUR 1355 |
TRPV6 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV695891 |
ABM |
1.0 ug DNA |
EUR 1355 |
TRPV6 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV695892 |
ABM |
1.0 ug DNA |
EUR 1355 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
TRPV6 Rabbit Polyclonal Antibody