ULK4 Polyclonal Antibody |
ABP60854-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ULK4 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of ULK4 from Human, Mouse. This ULK4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ULK4 protein |
ULK4 Rabbit pAb |
A7471-100ul |
Abclonal |
100 ul |
EUR 308 |
ULK4 Rabbit pAb |
A7471-200ul |
Abclonal |
200 ul |
EUR 459 |
ULK4 Rabbit pAb |
A7471-20ul |
Abclonal |
20 ul |
EUR 183 |
ULK4 Rabbit pAb |
A7471-50ul |
Abclonal |
50 ul |
EUR 223 |
ULK4 Antibody |
43614-100ul |
SAB |
100ul |
EUR 252 |
ULK4 Antibody |
DF9891 |
Affbiotech |
200ul |
EUR 304 |
Description: ULK4 Antibody detects endogenous levels of total ULK4. |
ULK4 Antibody |
1-CSB-PA853394ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against ULK4. Recognizes ULK4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
ULK4 Antibody |
1-CSB-PA853394ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against ULK4. Recognizes ULK4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Polyclonal ULK4 Antibody (C-Terminus) |
AMM08433G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ULK4 (C-Terminus). This antibody is tested and proven to work in the following applications: |
Serine/threonine-Protein Kinase ULK4 (ULK4) Antibody |
abx122774-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase ULK4 (ULK4) Antibody |
20-abx006976 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase ULK4 (ULK4) Antibody |
20-abx320936 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase ULK4 (ULK4) Antibody |
20-abx320937 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ULK4 Conjugated Antibody |
C43614 |
SAB |
100ul |
EUR 397 |
Anti-ULK4 antibody |
STJ29607 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. |
Anti-ULK4 antibody |
STJ191375 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to ULK4 |
ULK4 siRNA |
20-abx939011 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ULK4 siRNA |
20-abx939012 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-ULK4 |
YF-PA19493 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to ULK4 |
anti-ULK4 |
YF-PA19494 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to ULK4 |
ULK4 Blocking Peptide |
DF9891-BP |
Affbiotech |
1mg |
EUR 195 |
ULK4 cloning plasmid |
CSB-CL853394HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1743
- Sequence: atggaaaactttattctgtatgaggagatcggaagaggaagcaagactgttgtctataaagggcgacggaagggaacaatcaattttgtagccattctttgtactgataagtgcaaaaggcctgaaataaccaactgggtccgtctcacccgtgaaataaaacacaagaatattg
- Show more
|
Description: A cloning plasmid for the ULK4 gene. |
Human Serine/threonine- protein kinase ULK4, ULK4 ELISA KIT |
ELI-44741h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse Serine/threonine- protein kinase ULK4, Ulk4 ELISA KIT |
ELI-51201m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse ULK4 shRNA Plasmid |
20-abx980592 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human ULK4 shRNA Plasmid |
20-abx960382 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Anti-ULK4 (4A10-1A7) |
YF-MA18713 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to ULK4 |
h ULK4 inducible lentiviral particles |
LVP164 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, ULK4 , is fully sequence verified and matched to NCBI accession ID: NM_017886.2 |
ULK4 ORF Vector (Human) (pORF) |
ORF011322 |
ABM |
1.0 ug DNA |
EUR 95 |
Ulk4 ORF Vector (Mouse) (pORF) |
ORF061031 |
ABM |
1.0 ug DNA |
EUR 506 |
Monoclonal ULK4 Antibody (monoclonal) (M01), Clone: 4A10-1A7 |
AMM08434G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human ULK4 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4A10-1A7. This antibody is applicable in WB, E |
ULK4 sgRNA CRISPR Lentivector set (Human) |
K2587701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ulk4 sgRNA CRISPR Lentivector set (Mouse) |
K3603101 |
ABM |
3 x 1.0 ug |
EUR 339 |
ULK4-IT1 ORF Vector (Human) (pORF) |
ORF035491 |
ABM |
1.0 ug DNA |
Ask for price |
ULK4 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2587702 |
ABM |
1.0 ug DNA |
EUR 154 |
ULK4 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2587703 |
ABM |
1.0 ug DNA |
EUR 154 |
ULK4 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2587704 |
ABM |
1.0 ug DNA |
EUR 154 |
Ulk4 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3603102 |
ABM |
1.0 ug DNA |
EUR 154 |
Ulk4 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3603103 |
ABM |
1.0 ug DNA |
EUR 154 |
Ulk4 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3603104 |
ABM |
1.0 ug DNA |
EUR 154 |
ULK4 Protein Vector (Human) (pPB-C-His) |
PV045285 |
ABM |
500 ng |
EUR 329 |
ULK4 Protein Vector (Human) (pPB-N-His) |
PV045286 |
ABM |
500 ng |
EUR 329 |
ULK4 Protein Vector (Human) (pPM-C-HA) |
PV045287 |
ABM |
500 ng |
EUR 329 |
ULK4 Protein Vector (Human) (pPM-C-His) |
PV045288 |
ABM |
500 ng |
EUR 329 |
ULK4 Protein Vector (Mouse) (pPB-C-His) |
PV244122 |
ABM |
500 ng |
EUR 1065 |
ULK4 Protein Vector (Mouse) (pPB-N-His) |
PV244123 |
ABM |
500 ng |
EUR 1065 |
ULK4 Protein Vector (Mouse) (pPM-C-HA) |
PV244124 |
ABM |
500 ng |
EUR 1065 |
ULK4 Protein Vector (Mouse) (pPM-C-His) |
PV244125 |
ABM |
500 ng |
EUR 1065 |
Ulk4 3'UTR GFP Stable Cell Line |
TU171577 |
ABM |
1.0 ml |
Ask for price |
ULK4 3'UTR GFP Stable Cell Line |
TU077824 |
ABM |
1.0 ml |
EUR 1394 |
Ulk4 3'UTR Luciferase Stable Cell Line |
TU121577 |
ABM |
1.0 ml |
Ask for price |
ULK4 3'UTR Luciferase Stable Cell Line |
TU027824 |
ABM |
1.0 ml |
EUR 1394 |
ULK4-IT1 Protein Vector (Human) (pPB-C-His) |
PV141962 |
ABM |
500 ng |
Ask for price |
ULK4-IT1 Protein Vector (Human) (pPB-N-His) |
PV141963 |
ABM |
500 ng |
Ask for price |
ULK4-IT1 Protein Vector (Human) (pPM-C-HA) |
PV141964 |
ABM |
500 ng |
Ask for price |
ULK4-IT1 Protein Vector (Human) (pPM-C-His) |
PV141965 |
ABM |
500 ng |
Ask for price |
ULK4-IT1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV755189 |
ABM |
1.0 ug DNA |
Ask for price |
ULK4-IT1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV755193 |
ABM |
1.0 ug DNA |
Ask for price |
ULK4-IT1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV755194 |
ABM |
1.0 ug DNA |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ULK4 Rabbit Polyclonal Antibody