VGLL4 Rabbit Polyclonal Antibody

VGLL4 Polyclonal Antibody

ABP60889-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human VGLL4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of VGLL4 from Human, Mouse. This VGLL4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VGLL4 protein

VGLL4 Polyclonal Antibody

ABP60889-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human VGLL4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of VGLL4 from Human, Mouse. This VGLL4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VGLL4 protein

Vgll4 Polyclonal Antibody

30377-100ul 100ul
EUR 252

Vgll4 Polyclonal Antibody

30377-50ul 50ul
EUR 187

Vgll4 Rabbit pAb

A18248-100ul 100 ul
EUR 308

Vgll4 Rabbit pAb

A18248-200ul 200 ul
EUR 459

Vgll4 Rabbit pAb

A18248-20ul 20 ul
EUR 183

Vgll4 Rabbit pAb

A18248-50ul 50 ul
EUR 223

Vgll4 Polyclonal Conjugated Antibody

C30377 100ul
EUR 397

VGLL4 Antibody

1-CSB-PA613487LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VGLL4. Recognizes VGLL4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

anti- VGLL4 antibody

FNab09399 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • Immunogen: vestigial like 4(Drosophila)
  • Uniprot ID: Q14135
  • Gene ID: 9686
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against VGLL4

Anti-VGLL4 antibody

PAab09399 100 ug
EUR 386

Anti-Vgll4 antibody

STJ11100205 100 µl
EUR 277

Anti-VGLL4 antibody

STJ112593 100 µl
EUR 277

Anti-VGLL4 antibody

STJ191524 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to VGLL4

VGLL4 siRNA

20-abx939408
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

VGLL4 siRNA

20-abx939409
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-VGLL4

PVT18528 2 ug
EUR 231

anti-VGLL4

YF-PA27455 50 ug
EUR 363
Description: Mouse polyclonal to VGLL4

VGLL4 Antibody, HRP conjugated

1-CSB-PA613487LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VGLL4. Recognizes VGLL4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

VGLL4 Antibody, FITC conjugated

1-CSB-PA613487LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VGLL4. Recognizes VGLL4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

VGLL4 Antibody, Biotin conjugated

1-CSB-PA613487LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VGLL4. Recognizes VGLL4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

VGLL4 cloning plasmid

CSB-CL613487HU-10ug 10ug
EUR 355
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 873
  • Sequence: atggagacgccattggatgttttgtccagggcagcatctctggtgcatgctgatgacgaaaaacgcgaagctgctctcaggggagaacccagaatgcagaccctgccggtggcctctgccctcagcagtcaccgcaccggccctcccccaatcagccccagcaagaggaagttcag
  • Show more
Description: A cloning plasmid for the VGLL4 gene.

pDONR223-VGLL4 Plasmid

PVTB00650 2 ug
EUR 356

VGLL4 ELISA KIT|Human

EF004192 96 Tests
EUR 689

Mouse Vgll4 ELISA KIT

ELI-40608m 96 Tests
EUR 865

Human VGLL4 ELISA KIT

ELI-51673h 96 Tests
EUR 824

Human VGLL4 shRNA Plasmid

20-abx956458
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse VGLL4 shRNA Plasmid

20-abx981962
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

VGLL4 Recombinant Protein (Human)

RP034321 100 ug Ask for price

VGLL4 Recombinant Protein (Rat)

RP236387 100 ug Ask for price

VGLL4 Recombinant Protein (Mouse)

RP183788 100 ug Ask for price

pCD513B-1-VGLL4 Plasmid

PVTB00650-4a 2 ug
EUR 356

Vgll4 ORF Vector (Rat) (pORF)

ORF078797 1.0 ug DNA
EUR 506

VGLL4 ORF Vector (Human) (pORF)

ORF011441 1.0 ug DNA
EUR 95

Vgll4 ORF Vector (Mouse) (pORF)

ORF061264 1.0 ug DNA
EUR 506

Transcription Cofactor Vestigial-Like Protein 4 (VGLL4) Antibody

20-abx126779
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Transcription Cofactor Vestigial-Like Protein 4 (VGLL4) Antibody

abx031040-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Transcription Cofactor Vestigial-Like Protein 4 (VGLL4) Antibody

abx031040-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Transcription Cofactor Vestigial-Like Protein 4 (VGLL4) Antibody

20-abx313318
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Transcription Cofactor Vestigial-Like Protein 4 (VGLL4) Antibody

abx239399-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

VGLL4 sgRNA CRISPR Lentivector set (Human)

K2611201 3 x 1.0 ug
EUR 339

Vgll4 sgRNA CRISPR Lentivector set (Mouse)

K4262301 3 x 1.0 ug
EUR 339

Vgll4 sgRNA CRISPR Lentivector set (Rat)

K7206601 3 x 1.0 ug
EUR 339

Transcription Cofactor Vestigial-Like Protein 4 (VGLL4) Antibody (HRP)

20-abx313319
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Transcription Cofactor Vestigial-Like Protein 4 (VGLL4) Antibody (FITC)

20-abx313320
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Transcription Cofactor Vestigial-Like Protein 4 (VGLL4) Antibody (Biotin)

20-abx313321
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

VGLL4 sgRNA CRISPR Lentivector (Human) (Target 1)

K2611202 1.0 ug DNA
EUR 154

VGLL4 sgRNA CRISPR Lentivector (Human) (Target 2)

K2611203 1.0 ug DNA
EUR 154

VGLL4 sgRNA CRISPR Lentivector (Human) (Target 3)

K2611204 1.0 ug DNA
EUR 154

Vgll4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4262302 1.0 ug DNA
EUR 154

Vgll4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4262303 1.0 ug DNA
EUR 154

Vgll4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4262304 1.0 ug DNA
EUR 154

Vgll4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7206602 1.0 ug DNA
EUR 154

Vgll4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7206603 1.0 ug DNA
EUR 154

Vgll4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7206604 1.0 ug DNA
EUR 154

VGLL4 Protein Vector (Human) (pPB-C-His)

PV045761 500 ng
EUR 329

VGLL4 Protein Vector (Human) (pPB-N-His)

PV045762 500 ng
EUR 329

VGLL4 Protein Vector (Human) (pPM-C-HA)

PV045763 500 ng
EUR 329

VGLL4 Protein Vector (Human) (pPM-C-His)

PV045764 500 ng
EUR 329

VGLL4 Protein Vector (Rat) (pPB-C-His)

PV315186 500 ng
EUR 603

VGLL4 Protein Vector (Rat) (pPB-N-His)

PV315187 500 ng
EUR 603

VGLL4 Protein Vector (Rat) (pPM-C-HA)

PV315188 500 ng
EUR 603

VGLL4 Protein Vector (Rat) (pPM-C-His)

PV315189 500 ng
EUR 603

VGLL4 Protein Vector (Mouse) (pPB-C-His)

PV245054 500 ng
EUR 603

VGLL4 Protein Vector (Mouse) (pPB-N-His)

PV245055 500 ng
EUR 603

VGLL4 Protein Vector (Mouse) (pPM-C-HA)

PV245056 500 ng
EUR 603

VGLL4 Protein Vector (Mouse) (pPM-C-His)

PV245057 500 ng
EUR 603

Vgll4 3'UTR GFP Stable Cell Line

TU171761 1.0 ml Ask for price

VGLL4 3'UTR GFP Stable Cell Line

TU078116 1.0 ml
EUR 1521

Vgll4 3'UTR Luciferase Stable Cell Line

TU121761 1.0 ml Ask for price

VGLL4 3'UTR Luciferase Stable Cell Line

TU028116 1.0 ml
EUR 1521

Vgll4 3'UTR Luciferase Stable Cell Line

TU223037 1.0 ml Ask for price

Vgll4 3'UTR GFP Stable Cell Line

TU273037 1.0 ml Ask for price

VGLL4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV629245 1.0 ug DNA
EUR 514

VGLL4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV629249 1.0 ug DNA
EUR 514

VGLL4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV629250 1.0 ug DNA
EUR 514

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VGLL4 Rabbit Polyclonal Antibody