VRK1 Rabbit Polyclonal Antibody

VRK1 Polyclonal Antibody
ABP60902-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human VRK1 protein Applications tips:
Description: A polyclonal antibody for detection of VRK1 from Human, Mouse. This VRK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VRK1 protein

VRK1 Polyclonal Antibody
ES10218-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VRK1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

VRK1 Polyclonal Antibody
ES10218-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VRK1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

VRK1 Rabbit pAb
A7745-100ul	Abclonal	100 ul	EUR 308

VRK1 Rabbit pAb
A7745-200ul	Abclonal	200 ul	EUR 459

VRK1 Rabbit pAb
A7745-20ul	Abclonal	20 ul	EUR 183

VRK1 Rabbit pAb
A7745-50ul	Abclonal	50 ul	EUR 223

Polyclonal VRK1 Antibody (Center)
APR05905G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VRK1 (Center). This antibody is tested and proven to work in the following applications:

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit
DLR-VRK1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Vaccinia Related Kinase 1 (VRK1) in samples from serum, plasma or other biological fluids.

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit
DLR-VRK1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Vaccinia Related Kinase 1 (VRK1) in samples from serum, plasma or other biological fluids.

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit
RDR-VRK1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit
RDR-VRK1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit
RD-VRK1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit
RD-VRK1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

VRK1 Antibody
43595-100ul	SAB	100ul	EUR 252

VRK1 Antibody
1-CSB-PA857466DSR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against VRK1. Recognizes VRK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

VRK1 Antibody
DF9892	Affbiotech	200ul	EUR 304
Description: VRK1 Antibody detects endogenous levels of total VRK1.

VRK1 Antibody
ABD13310	Lifescience Market	100 ug	EUR 438

VRK1 Antibody
ABD9892	Lifescience Market	100 ug	EUR 438

Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody
20-abx007048	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody
abx037186-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody
20-abx142305	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody
abx033380-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody
abx033380-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody
abx034922-100ul	Abbexa	100 ul	EUR 523
Shipped within 5-10 working days.

Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody
20-abx321912	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

[KO Validated] VRK1 Rabbit pAb
A19938-100ul	Abclonal	100 ul	EUR 410

[KO Validated] VRK1 Rabbit pAb
A19938-200ul	Abclonal	200 ul	EUR 571

[KO Validated] VRK1 Rabbit pAb
A19938-20ul	Abclonal	20 ul	EUR 221

[KO Validated] VRK1 Rabbit pAb
A19938-50ul	Abclonal	50 ul	EUR 287

VRK1 Conjugated Antibody
C43595	SAB	100ul	EUR 397

Anti-VRK1 Antibody
PB9907	BosterBio	100ug/vial	EUR 294

Anti-VRK1 antibody
STJ11100814	St John's Laboratory	100 µl	EUR 413
Description: This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, thymus, fetal liver, and carcinomas. Its protein localizes to the nucleus and has been shown to promote the stability and nuclear accumulation of a transcriptionally active p53 molecule and, in vitro, to phosphorylate Thr18 of p53 and reduce p53 ubiquitination. This gene, therefore, may regulate cell proliferation. This protein also phosphorylates histone, casein, and the transcription factors ATF2 (activating transcription factor 2) and c-JUN.

Anti-VRK1 antibody
STJ110056	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, thymus, fetal liver, and carcinomas. Its protein localizes to the nucleus and has been shown to promote the stability and nuclear accumulation of a transcriptionally active p53 molecule and, in vitro, to phosphorylate Thr18 of p53 and reduce p53 ubiquitination. This gene, therefore, may regulate cell proliferation. This protein also phosphorylates histone, casein, and the transcription factors ATF2 (activating transcription factor 2) and c-JUN.

Anti-VRK1 antibody
STJ191376	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to VRK1

VRK1 siRNA
20-abx939552	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

VRK1 siRNA
20-abx939553	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-VRK1
YF-PA15288	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to VRK1

anti-VRK1
YF-PA15289	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to VRK1

anti-VRK1
YF-PA15290	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to VRK1

anti-VRK1
YF-PA24959	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to VRK1

Mouse Serine/threonine-protein kinase VRK1 (Vrk1)
1-CSB-EP768902MO	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 55.2 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Serine/threonine-protein kinase VRK1(Vrk1) expressed in E.coli

Mouse Serine/threonine-protein kinase VRK1 (Vrk1)
1-CSB-YP768902MOb1	Cusabio	EUR 504.00 EUR 265.00 EUR 1832.00 EUR 763.00 EUR 1216.00 EUR 334.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 53.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Serine/threonine-protein kinase VRK1(Vrk1) expressed in Yeast

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human)
4-PAC600Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VRK1 (Gly46~Glu292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1)

VRK1 Blocking Peptide
DF9892-BP	Affbiotech	1mg	EUR 195

VRK1 cloning plasmid
CSB-CL857466HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1191 Sequence: atgcctcgtgtaaaagcagctcaagctggaagacagagctctgcaaagagacatcttgcagaacaatttgcagttggagagataataactgacatggcaaaaaaggaatggaaagtaggattacccattggccaaggaggctttggctgtatatatcttgctgatatgaattctt Show more
Description: A cloning plasmid for the VRK1 gene.

Anti-VRK1 (4F9)
YF-MA16064	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to VRK1

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), APC
4-PAC600Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VRK1 (Gly46~Glu292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with APC.

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), Biotinylated
4-PAC600Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VRK1 (Gly46~Glu292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with Biotin.

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), Cy3
4-PAC600Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VRK1 (Gly46~Glu292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with Cy3.

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), FITC
4-PAC600Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VRK1 (Gly46~Glu292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with FITC.

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), HRP
4-PAC600Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VRK1 (Gly46~Glu292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with HRP.

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), PE
4-PAC600Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VRK1 (Gly46~Glu292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with PE.

Mouse Serine/threonine- protein kinase VRK1, Vrk1 ELISA KIT
ELI-16975m	Lifescience Market	96 Tests	EUR 865

Human Serine/threonine- protein kinase VRK1, VRK1 ELISA KIT
ELI-17460h	Lifescience Market	96 Tests	EUR 824

Mouse Serine/threonine-protein kinase VRK1 (VRK1) ELISA Kit
abx390835-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Bovine Serine/threonine- protein kinase VRK1, VRK1 ELISA KIT
ELI-35280b	Lifescience Market	96 Tests	EUR 928

Vrk1 ELISA Kit| Mouse Serine/threonine-protein kinase VRK1 ELIS
EF016479	Lifescience Market	96 Tests	EUR 689

VRK1 ELISA Kit| Bovine Serine/threonine-protein kinase VRK1 ELI
EF012014	Lifescience Market	96 Tests	EUR 689

ELISA kit for Human Serine/threonine-protein kinase VRK1 (VRK1)
KTE60047-48T	Abbkine	48T	EUR 332
Serine/threonine-protein kinase VRK2 is an a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those Show more
Description: Quantitative sandwich ELISA for measuring Human Serine/threonine-protein kinase VRK1 (VRK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Serine/threonine-protein kinase VRK1 (VRK1)
KTE60047-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Serine/threonine-protein kinase VRK2 is an a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those Show more
Description: Quantitative sandwich ELISA for measuring Human Serine/threonine-protein kinase VRK1 (VRK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Serine/threonine-protein kinase VRK1 (VRK1)
KTE60047-96T	Abbkine	96T	EUR 539
Serine/threonine-protein kinase VRK2 is an a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those Show more
Description: Quantitative sandwich ELISA for measuring Human Serine/threonine-protein kinase VRK1 (VRK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Vaccinia Related Kinase 1 (VRK1) Antibody
20-abx102584	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Vaccinia Related Kinase 1 (VRK1) Antibody
20-abx175051	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Anti-VRK1 (human) (1F6) Monoclonal Antibody
M03396	BosterBio	100ug	EUR 397
Description: Mouse Monoclonal VRK1 (human) (1F6) Antibody. Validated in WB and tested in Human.

VRK1 ELISA KIT|Human
EF005692	Lifescience Market	96 Tests	EUR 689

Mouse VRK1 shRNA Plasmid
20-abx973379	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human VRK1 shRNA Plasmid
20-abx955093	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), APC-Cy7
4-PAC600Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VRK1 (Gly46~Glu292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with APC-Cy7.

Monoclonal VRK1 Antibody (Center)(Ascites), Clone: 1015CT2.1.1
AMM02470G	Leading Biology	100μl	EUR 484
Description: A Monoclonal antibody against Human VRK1 (Center)(Ascites). The antibodies are raised in Mouse and are from clone 1015CT2.1.1. This antibody is applicable in WB, E

Vrk1 ORF Vector (Mouse) (pORF)
ORF061658	ABM	1.0 ug DNA	EUR 506

Vrk1 ORF Vector (Mouse) (pORF)
ORF061659	ABM	1.0 ug DNA	EUR 506

Vrk1 ORF Vector (Mouse) (pORF)
ORF061660	ABM	1.0 ug DNA	EUR 506

Vrk1 ORF Vector (Rat) (pORF)
ORF079024	ABM	1.0 ug DNA	EUR 506

VRK1 ORF Vector (Human) (pORF)
ORF035819	ABM	1.0 ug DNA	EUR 405

VRK1 ELISA Kit (Human) (OKCD00339)
OKCD00339	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Serine/threonine kinase involved in Golgi disassembly during the cell cycle: following phosphorylation by PLK3 during mitosis, required to induce Golgi fragmentation. Acts by mediating phosphorylation of downstream target protein. Phosphorylates 'Thr-18' of p53/TP53 and may thereby prevent the interaction between p53/TP53 and MDM2. Phosphorylates casein and histone H3. Phosphorylates BANF1: disrupts its ability to bind DNA, reduces its binding to LEM domain-containing proteins and causes its relocalization from the nucleus to the cytoplasm. Phosphorylates ATF2 which activates its transcriptional activity.6 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.3"The human vaccinia-related kinase 1 (VRK1) phosphorylates threonine-18 within the mdm-2 binding site of the p53 tumour suppressor protein."_x005F_x005F_x000D_Lopez-Borges S., Lazo P.A._x005F_x005F_x000D_Oncogene 19:3656-3664(2000) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, AUTOPHOSPHORYLATION, MUTAGENESIS OF SER-14; THR-102; SER-125; SER-150; SER-158; SER-239; THR-305; THR-312; THR-355 AND THR-390.Ref.5"Characterization of three paralogous members of the Mammalian vaccinia related kinase family."_x005F_x005F_x000D_Nichols R.J., Traktman P._x005F_x005F_x000D_J. Biol. Chem. 279:7934-7946(2004) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, PHOSPHORYLATION.Ref.6"Human vaccinia-related kinase 1 (VRK1) activates the ATF2 transcriptional activity by novel phosphorylation on Thr-73 and Ser-62 and cooperates with JNK."_x005F_x005F_x000D_Sevilla A., Santos C.R., Vega F.M., Lazo P.A._x005F_x005F_x000D_J. Biol. Chem. 279:27458-27465(2004) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION.Ref.8"The vaccinia-related kinases phosphorylate the N' terminus of BAF, regulating its interaction with DNA and its retention in the nucleus."_x005F_x005F_x000D_Nichols R.J., Wiebe M.S., Traktman P._x005F_x005F_x000D_Mol. Biol. Cell 17:2451-2464(2006) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.9"Proteomics identification of nuclear Ran GTPase as an inhibitor of human VRK1 and VRK2 (vaccinia-related kinase) activities."_x005F_x005F_x000D_Sanz-Garcia M., Lopez-Sanchez I., Lazo P.A._x005F_x005F_x000D_Mol. Cell. Proteomics 7:2199-2214(2008) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, INTERACTION WITH RAN, ENZYME REGULATION.Ref.11"Plk3 interacts with and specifically phosphorylates VRK1 in Ser342, a downstream target in a pathway that induces Golgi fragmentation."_x005F_x005F_x000D_Lopez-Sanchez I., Sanz-Garcia M., Lazo P.A._x005F_x005F_x000D_Mol. Cell. Biol. 29:1189-1201(2009) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, PHOSPHORYLATION AT SER-342, MUTAGENESIS OF LYS-179 AND SER-342. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.061 ng/mL

VRK1 ELISA Kit (Human) (OKDD00592)
OKDD00592	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, thymus, fetal liver, and carcinomas. Its protein localizes to the nucleus and has been shown to promote the stability and nuclear accumulation of a transcriptionally active p53 molecule and, in vitro, to phosphorylate Thr18 of p53 and reduce p53 ubiquitination. This gene, therefore, may regulate cell proliferation. This protein also phosphorylates histone, casein, and the transcription factors ATF2 (activating transcription factor 2) and c-JUN.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.062 ng/mL

Vrk1 sgRNA CRISPR Lentivector set (Rat)
K6439101	ABM	3 x 1.0 ug	EUR 339

VRK1 sgRNA CRISPR Lentivector set (Human)
K2620201	ABM	3 x 1.0 ug	EUR 339

Vrk1 sgRNA CRISPR Lentivector set (Mouse)
K4353401	ABM	3 x 1.0 ug	EUR 339

Recombinant Vaccinia Related Kinase 1 (VRK1)
4-RPC600Hu01	Cloud-Clone	EUR 501.41 EUR 237.00 EUR 1605.28 EUR 601.76 EUR 1103.52 EUR 398.00 EUR 3863.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q99986 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 29.9kDa Isoelectric Point: Inquire
Description: Recombinant Human Vaccinia Related Kinase 1 expressed in: E.coli

Human Vaccinia Related Kinase 1 (VRK1) Protein
20-abx069616	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Vrk1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6439102	ABM	1.0 ug DNA	EUR 154

Vrk1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6439103	ABM	1.0 ug DNA	EUR 154

Vrk1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6439104	ABM	1.0 ug DNA	EUR 154

VRK1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2620202	ABM	1.0 ug DNA	EUR 154

VRK1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2620203	ABM	1.0 ug DNA	EUR 154

VRK1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2620204	ABM	1.0 ug DNA	EUR 154

Vrk1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4353402	ABM	1.0 ug DNA	EUR 154

Vrk1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4353403	ABM	1.0 ug DNA	EUR 154

Vrk1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4353404	ABM	1.0 ug DNA	EUR 154

VRK1 Protein Vector (Mouse) (pPB-C-His)
PV246630	ABM	500 ng	EUR 603

VRK1 Protein Vector (Mouse) (pPB-N-His)
PV246631	ABM	500 ng	EUR 603

VRK1 Protein Vector (Mouse) (pPM-C-HA)
PV246632	ABM	500 ng	EUR 603

VRK1 Protein Vector (Mouse) (pPM-C-His)
PV246633	ABM	500 ng	EUR 603

VRK1 Protein Vector (Mouse) (pPB-C-His)
PV246634	ABM	500 ng	EUR 603

VRK1 Protein Vector (Mouse) (pPB-N-His)
PV246635	ABM	500 ng	EUR 603

VRK1 Protein Vector (Mouse) (pPM-C-HA)
PV246636	ABM	500 ng	EUR 603

VRK1 Protein Vector (Mouse) (pPM-C-His)
PV246637	ABM	500 ng	EUR 603

VRK1 Protein Vector (Mouse) (pPB-C-His)
PV246638	ABM	500 ng	EUR 603

VRK1 Protein Vector (Mouse) (pPB-N-His)
PV246639	ABM	500 ng	EUR 603

VRK1 Protein Vector (Mouse) (pPM-C-HA)
PV246640	ABM	500 ng	EUR 603

VRK1 Protein Vector (Mouse) (pPM-C-His)
PV246641	ABM	500 ng	EUR 603

VRK1 Protein Vector (Human) (pPB-C-His)
PV143274	ABM	500 ng	EUR 552

VRK1 Protein Vector (Human) (pPB-N-His)
PV143275	ABM	500 ng	EUR 552

VRK1 Protein Vector (Human) (pPM-C-HA)
PV143276	ABM	500 ng	EUR 552

VRK1 Protein Vector (Human) (pPM-C-His)
PV143277	ABM	500 ng	EUR 552

VRK1 Protein Vector (Rat) (pPB-C-His)
PV316094	ABM	500 ng	EUR 603

VRK1 Protein Vector (Rat) (pPB-N-His)
PV316095	ABM	500 ng	EUR 603

VRK1 Protein Vector (Rat) (pPM-C-HA)
PV316096	ABM	500 ng	EUR 603

VRK1 Protein Vector (Rat) (pPM-C-His)
PV316097	ABM	500 ng	EUR 603

Vrk1 3'UTR Luciferase Stable Cell Line
TU122146	ABM	1.0 ml	Ask for price

VRK1 3'UTR GFP Stable Cell Line
TU078307	ABM	1.0 ml	EUR 1394

Vrk1 3'UTR GFP Stable Cell Line
TU172146	ABM	1.0 ml	Ask for price

Vrk1 3'UTR Luciferase Stable Cell Line
TU223270	ABM	1.0 ml	Ask for price

VRK1 3'UTR Luciferase Stable Cell Line
TU028307	ABM	1.0 ml	EUR 1394

Vrk1 3'UTR GFP Stable Cell Line
TU273270	ABM	1.0 ml	Ask for price

Human Vaccinia Related Kinase 1 (VRK1)ELISA Kit
201-12-2457	SunredBio	96 tests	EUR 440
This Vaccinia Related Kinase 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit
20-abx153490	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Vaccinia Related Kinase 1 (VRK1) CLIA Kit
20-abx493787	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Vaccinia Related Kinase 1(VRK1)ELISA Kit
QY-E02017	Qayee Biotechnology	96T	EUR 361

VRK1 Rabbit Polyclonal Antibody