VRK1 Rabbit Polyclonal Antibody

VRK1 Polyclonal Antibody

ABP60902-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human VRK1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of VRK1 from Human, Mouse. This VRK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VRK1 protein

VRK1 Polyclonal Antibody

ABP60902-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human VRK1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of VRK1 from Human, Mouse. This VRK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VRK1 protein

VRK1 Polyclonal Antibody

ABP60902-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human VRK1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of VRK1 from Human, Mouse. This VRK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VRK1 protein

VRK1 Rabbit pAb

A7745-100ul 100 ul
EUR 308

VRK1 Rabbit pAb

A7745-200ul 200 ul
EUR 459

VRK1 Rabbit pAb

A7745-20ul 20 ul
EUR 183

VRK1 Rabbit pAb

A7745-50ul 50 ul
EUR 223

Polyclonal VRK1 Antibody (Center)

APR05905G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VRK1 (Center). This antibody is tested and proven to work in the following applications:

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit

DLR-VRK1-Hu-48T 48T
EUR 517
  • Should the Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Vaccinia Related Kinase 1 (VRK1) in samples from serum, plasma or other biological fluids.

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit

DLR-VRK1-Hu-96T 96T
EUR 673
  • Should the Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Vaccinia Related Kinase 1 (VRK1) in samples from serum, plasma or other biological fluids.

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit

RDR-VRK1-Hu-48Tests 48 Tests
EUR 544

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit

RDR-VRK1-Hu-96Tests 96 Tests
EUR 756

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit

RD-VRK1-Hu-48Tests 48 Tests
EUR 521

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit

RD-VRK1-Hu-96Tests 96 Tests
EUR 723

VRK1 Antibody

ABD9892 100 ug
EUR 438

VRK1 Antibody

ABD13310 100 ug
EUR 438

VRK1 Antibody

43595-100ul 100ul
EUR 252

VRK1 Antibody

DF9892 200ul
EUR 304
Description: VRK1 Antibody detects endogenous levels of total VRK1.

VRK1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against VRK1. Recognizes VRK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody

abx034922-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody

abx037186-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody

abx033380-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody

abx033380-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

[KO Validated] VRK1 Rabbit pAb

A19938-100ul 100 ul
EUR 410

[KO Validated] VRK1 Rabbit pAb

A19938-200ul 200 ul
EUR 571

[KO Validated] VRK1 Rabbit pAb

A19938-20ul 20 ul
EUR 221

[KO Validated] VRK1 Rabbit pAb

A19938-50ul 50 ul
EUR 287

VRK1 Conjugated Antibody

C43595 100ul
EUR 397

Anti-VRK1 Antibody

PB9907 100ug/vial
EUR 294

Anti-VRK1 antibody

STJ110056 100 µl
EUR 277
Description: This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, thymus, fetal liver, and carcinomas. Its protein localizes to the nucleus and has been shown to promote the stability and nuclear accumulation of a transcriptionally active p53 molecule and, in vitro, to phosphorylate Thr18 of p53 and reduce p53 ubiquitination. This gene, therefore, may regulate cell proliferation. This protein also phosphorylates histone, casein, and the transcription factors ATF2 (activating transcription factor 2) and c-JUN.

Anti-VRK1 antibody

STJ11100814 100 µl
EUR 413
Description: This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, thymus, fetal liver, and carcinomas. Its protein localizes to the nucleus and has been shown to promote the stability and nuclear accumulation of a transcriptionally active p53 molecule and, in vitro, to phosphorylate Thr18 of p53 and reduce p53 ubiquitination. This gene, therefore, may regulate cell proliferation. This protein also phosphorylates histone, casein, and the transcription factors ATF2 (activating transcription factor 2) and c-JUN.

Anti-VRK1 antibody

STJ191376 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to VRK1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA15288 50 ug
EUR 363
Description: Mouse polyclonal to VRK1


YF-PA15289 100 ul
EUR 403
Description: Rabbit polyclonal to VRK1


YF-PA15290 100 ug
EUR 403
Description: Rabbit polyclonal to VRK1


YF-PA24959 50 ul
EUR 334
Description: Mouse polyclonal to VRK1

Mouse Serine/threonine-protein kinase VRK1 (Vrk1)

  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 53.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Serine/threonine-protein kinase VRK1(Vrk1) expressed in Yeast

Mouse Serine/threonine-protein kinase VRK1 (Vrk1)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 55.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Serine/threonine-protein kinase VRK1(Vrk1) expressed in E.coli

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VRK1 (Gly46~Glu292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1)

VRK1 cloning plasmid

CSB-CL857466HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1191
  • Sequence: atgcctcgtgtaaaagcagctcaagctggaagacagagctctgcaaagagacatcttgcagaacaatttgcagttggagagataataactgacatggcaaaaaaggaatggaaagtaggattacccattggccaaggaggctttggctgtatatatcttgctgatatgaattctt
  • Show more
Description: A cloning plasmid for the VRK1 gene.

VRK1 Blocking Peptide

DF9892-BP 1mg
EUR 195

Anti-VRK1 (4F9)

YF-MA16064 100 ug
EUR 363
Description: Mouse monoclonal to VRK1

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VRK1 (Gly46~Glu292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with APC.

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VRK1 (Gly46~Glu292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with Biotin.

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VRK1 (Gly46~Glu292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with Cy3.

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VRK1 (Gly46~Glu292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with FITC.

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VRK1 (Gly46~Glu292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with HRP.

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VRK1 (Gly46~Glu292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with PE.

Mouse Serine/threonine- protein kinase VRK1, Vrk1 ELISA KIT

ELI-16975m 96 Tests
EUR 865

Human Serine/threonine- protein kinase VRK1, VRK1 ELISA KIT

ELI-17460h 96 Tests
EUR 824

Bovine Serine/threonine- protein kinase VRK1, VRK1 ELISA KIT

ELI-35280b 96 Tests
EUR 928

Mouse Serine/threonine-protein kinase VRK1 (VRK1) ELISA Kit

abx390835-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Vrk1 ELISA Kit| Mouse Serine/threonine-protein kinase VRK1 ELIS

EF016479 96 Tests
EUR 689

VRK1 ELISA Kit| Bovine Serine/threonine-protein kinase VRK1 ELI

EF012014 96 Tests
EUR 689

ELISA kit for Human Serine/threonine-protein kinase VRK1 (VRK1)

KTE60047-48T 48T
EUR 332
  • Serine/threonine-protein kinase VRK2 is an a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Serine/threonine-protein kinase VRK1 (VRK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Serine/threonine-protein kinase VRK1 (VRK1)

KTE60047-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Serine/threonine-protein kinase VRK2 is an a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Serine/threonine-protein kinase VRK1 (VRK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Serine/threonine-protein kinase VRK1 (VRK1)

KTE60047-96T 96T
EUR 539
  • Serine/threonine-protein kinase VRK2 is an a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Serine/threonine-protein kinase VRK1 (VRK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Vaccinia Related Kinase 1 (VRK1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Vaccinia Related Kinase 1 (VRK1) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Anti-VRK1 (human) (1F6) Monoclonal Antibody

M03396 100ug
EUR 397
Description: Mouse Monoclonal VRK1 (human) (1F6) Antibody. Validated in WB and tested in Human.


EF005692 96 Tests
EUR 689

Human VRK1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse VRK1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VRK1 (Gly46~Glu292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with APC-Cy7.

Monoclonal VRK1 Antibody (Center)(Ascites), Clone: 1015CT2.1.1

AMM02470G 100μl
EUR 484
Description: A Monoclonal antibody against Human VRK1 (Center)(Ascites). The antibodies are raised in Mouse and are from clone 1015CT2.1.1. This antibody is applicable in WB, E

VRK1 ORF Vector (Human) (pORF)

ORF035819 1.0 ug DNA
EUR 405

Vrk1 ORF Vector (Rat) (pORF)

ORF079024 1.0 ug DNA
EUR 506

Vrk1 ORF Vector (Mouse) (pORF)

ORF061658 1.0 ug DNA
EUR 506

Vrk1 ORF Vector (Mouse) (pORF)

ORF061659 1.0 ug DNA
EUR 506

Vrk1 ORF Vector (Mouse) (pORF)

ORF061660 1.0 ug DNA
EUR 506

VRK1 sgRNA CRISPR Lentivector set (Human)

K2620201 3 x 1.0 ug
EUR 339

Vrk1 sgRNA CRISPR Lentivector set (Mouse)

K4353401 3 x 1.0 ug
EUR 339

Vrk1 sgRNA CRISPR Lentivector set (Rat)

K6439101 3 x 1.0 ug
EUR 339

Recombinant Vaccinia Related Kinase 1 (VRK1)

  • EUR 501.41
  • EUR 237.00
  • EUR 1605.28
  • EUR 601.76
  • EUR 1103.52
  • EUR 398.00
  • EUR 3863.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q99986
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Vaccinia Related Kinase 1 expressed in: E.coli

Human Vaccinia Related Kinase 1 (VRK1) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

VRK1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2620202 1.0 ug DNA
EUR 154

VRK1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2620203 1.0 ug DNA
EUR 154

VRK1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2620204 1.0 ug DNA
EUR 154

Vrk1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4353402 1.0 ug DNA
EUR 154

Vrk1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4353403 1.0 ug DNA
EUR 154

Vrk1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4353404 1.0 ug DNA
EUR 154

Vrk1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6439102 1.0 ug DNA
EUR 154

Vrk1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6439103 1.0 ug DNA
EUR 154

Vrk1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6439104 1.0 ug DNA
EUR 154

VRK1 Protein Vector (Rat) (pPB-C-His)

PV316094 500 ng
EUR 603

VRK1 Protein Vector (Rat) (pPB-N-His)

PV316095 500 ng
EUR 603

VRK1 Protein Vector (Rat) (pPM-C-HA)

PV316096 500 ng
EUR 603

VRK1 Protein Vector (Rat) (pPM-C-His)

PV316097 500 ng
EUR 603

VRK1 Protein Vector (Human) (pPB-C-His)

PV143274 500 ng
EUR 552

VRK1 Protein Vector (Human) (pPB-N-His)

PV143275 500 ng
EUR 552

VRK1 Protein Vector (Human) (pPM-C-HA)

PV143276 500 ng
EUR 552

VRK1 Protein Vector (Human) (pPM-C-His)

PV143277 500 ng
EUR 552

VRK1 Protein Vector (Mouse) (pPB-C-His)

PV246630 500 ng
EUR 603

VRK1 Protein Vector (Mouse) (pPB-N-His)

PV246631 500 ng
EUR 603

VRK1 Protein Vector (Mouse) (pPM-C-HA)

PV246632 500 ng
EUR 603

VRK1 Protein Vector (Mouse) (pPM-C-His)

PV246633 500 ng
EUR 603

VRK1 Protein Vector (Mouse) (pPB-C-His)

PV246634 500 ng
EUR 603

VRK1 Protein Vector (Mouse) (pPB-N-His)

PV246635 500 ng
EUR 603

VRK1 Protein Vector (Mouse) (pPM-C-HA)

PV246636 500 ng
EUR 603

VRK1 Protein Vector (Mouse) (pPM-C-His)

PV246637 500 ng
EUR 603

VRK1 Protein Vector (Mouse) (pPB-C-His)

PV246638 500 ng
EUR 603

VRK1 Protein Vector (Mouse) (pPB-N-His)

PV246639 500 ng
EUR 603

VRK1 Protein Vector (Mouse) (pPM-C-HA)

PV246640 500 ng
EUR 603

VRK1 Protein Vector (Mouse) (pPM-C-His)

PV246641 500 ng
EUR 603

Vrk1 3'UTR GFP Stable Cell Line

TU172146 1.0 ml Ask for price

VRK1 3'UTR GFP Stable Cell Line

TU078307 1.0 ml
EUR 1394

Vrk1 3'UTR Luciferase Stable Cell Line

TU122146 1.0 ml Ask for price

VRK1 3'UTR Luciferase Stable Cell Line

TU028307 1.0 ml
EUR 1394

Vrk1 3'UTR Luciferase Stable Cell Line

TU223270 1.0 ml Ask for price

Vrk1 3'UTR GFP Stable Cell Line

TU273270 1.0 ml Ask for price

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Vaccinia Related Kinase 1 (VRK1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Vaccinia Related Kinase 1 (VRK1)ELISA Kit

201-12-2457 96 tests
EUR 440
  • This Vaccinia Related Kinase 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit

SEC600Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vaccinia Related Kinase 1 (VRK1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vaccinia Related Kinase 1 (VRK1) in serum, plasma and other biological fluids.

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit

SEC600Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vaccinia Related Kinase 1 (VRK1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vaccinia Related Kinase 1 (VRK1) in serum, plasma and other biological fluids.

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit

SEC600Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vaccinia Related Kinase 1 (VRK1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vaccinia Related Kinase 1 (VRK1) in serum, plasma and other biological fluids.

VRK1 Rabbit Polyclonal Antibody