VRK1 Polyclonal Antibody |
ABP60902-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human VRK1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of VRK1 from Human, Mouse. This VRK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VRK1 protein |
VRK1 Polyclonal Antibody |
ABP60902-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human VRK1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of VRK1 from Human, Mouse. This VRK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VRK1 protein |
VRK1 Polyclonal Antibody |
ABP60902-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human VRK1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of VRK1 from Human, Mouse. This VRK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VRK1 protein |
VRK1 Rabbit pAb |
A7745-100ul |
Abclonal |
100 ul |
EUR 308 |
VRK1 Rabbit pAb |
A7745-200ul |
Abclonal |
200 ul |
EUR 459 |
VRK1 Rabbit pAb |
A7745-20ul |
Abclonal |
20 ul |
EUR 183 |
VRK1 Rabbit pAb |
A7745-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal VRK1 Antibody (Center) |
APR05905G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VRK1 (Center). This antibody is tested and proven to work in the following applications: |
Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit |
DLR-VRK1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Vaccinia Related Kinase 1 (VRK1) in samples from serum, plasma or other biological fluids. |
Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit |
DLR-VRK1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Vaccinia Related Kinase 1 (VRK1) in samples from serum, plasma or other biological fluids. |
Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit |
RDR-VRK1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit |
RDR-VRK1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit |
RD-VRK1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit |
RD-VRK1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
VRK1 Antibody |
43595-100ul |
SAB |
100ul |
EUR 252 |
VRK1 Antibody |
DF9892 |
Affbiotech |
200ul |
EUR 304 |
Description: VRK1 Antibody detects endogenous levels of total VRK1. |
VRK1 Antibody |
1-CSB-PA857466DSR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against VRK1. Recognizes VRK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody |
20-abx142305 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody |
abx034922-100ul |
Abbexa |
100 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody |
abx037186-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody |
abx033380-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody |
abx033380-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody |
20-abx007048 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody |
20-abx321912 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
[KO Validated] VRK1 Rabbit pAb |
A19938-100ul |
Abclonal |
100 ul |
EUR 410 |
[KO Validated] VRK1 Rabbit pAb |
A19938-200ul |
Abclonal |
200 ul |
EUR 571 |
[KO Validated] VRK1 Rabbit pAb |
A19938-20ul |
Abclonal |
20 ul |
EUR 221 |
[KO Validated] VRK1 Rabbit pAb |
A19938-50ul |
Abclonal |
50 ul |
EUR 287 |
VRK1 Conjugated Antibody |
C43595 |
SAB |
100ul |
EUR 397 |
Anti-VRK1 Antibody |
PB9907 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-VRK1 antibody |
STJ110056 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, thymus, fetal liver, and carcinomas. Its protein localizes to the nucleus and has been shown to promote the stability and nuclear accumulation of a transcriptionally active p53 molecule and, in vitro, to phosphorylate Thr18 of p53 and reduce p53 ubiquitination. This gene, therefore, may regulate cell proliferation. This protein also phosphorylates histone, casein, and the transcription factors ATF2 (activating transcription factor 2) and c-JUN. |
Anti-VRK1 antibody |
STJ11100814 |
St John's Laboratory |
100 µl |
EUR 413 |
Description: This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, thymus, fetal liver, and carcinomas. Its protein localizes to the nucleus and has been shown to promote the stability and nuclear accumulation of a transcriptionally active p53 molecule and, in vitro, to phosphorylate Thr18 of p53 and reduce p53 ubiquitination. This gene, therefore, may regulate cell proliferation. This protein also phosphorylates histone, casein, and the transcription factors ATF2 (activating transcription factor 2) and c-JUN. |
Anti-VRK1 antibody |
STJ191376 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to VRK1 |
VRK1 siRNA |
20-abx939552 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VRK1 siRNA |
20-abx939553 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-VRK1 |
YF-PA15288 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to VRK1 |
anti-VRK1 |
YF-PA15289 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to VRK1 |
anti-VRK1 |
YF-PA15290 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to VRK1 |
anti-VRK1 |
YF-PA24959 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to VRK1 |
Mouse Serine/threonine-protein kinase VRK1 (Vrk1) |
1-CSB-YP768902MOb1 |
Cusabio |
-
EUR 504.00
-
EUR 265.00
-
EUR 1832.00
-
EUR 763.00
-
EUR 1216.00
-
EUR 334.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 53.7 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Serine/threonine-protein kinase VRK1(Vrk1) expressed in Yeast |
Mouse Serine/threonine-protein kinase VRK1 (Vrk1) |
1-CSB-EP768902MO |
Cusabio |
-
EUR 505.00
-
EUR 265.00
-
EUR 1827.00
-
EUR 766.00
-
EUR 1218.00
-
EUR 335.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 55.2 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Serine/threonine-protein kinase VRK1(Vrk1) expressed in E.coli |
Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human) |
4-PAC600Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VRK1 (Gly46~Glu292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1) |
VRK1 cloning plasmid |
CSB-CL857466HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1191
- Sequence: atgcctcgtgtaaaagcagctcaagctggaagacagagctctgcaaagagacatcttgcagaacaatttgcagttggagagataataactgacatggcaaaaaaggaatggaaagtaggattacccattggccaaggaggctttggctgtatatatcttgctgatatgaattctt
- Show more
|
Description: A cloning plasmid for the VRK1 gene. |
VRK1 Blocking Peptide |
DF9892-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-VRK1 (4F9) |
YF-MA16064 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to VRK1 |
Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), APC |
4-PAC600Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VRK1 (Gly46~Glu292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with APC. |
Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), Biotinylated |
4-PAC600Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VRK1 (Gly46~Glu292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with Biotin. |
Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), Cy3 |
4-PAC600Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VRK1 (Gly46~Glu292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with Cy3. |
Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), FITC |
4-PAC600Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VRK1 (Gly46~Glu292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with FITC. |
Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), HRP |
4-PAC600Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VRK1 (Gly46~Glu292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with HRP. |
Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), PE |
4-PAC600Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VRK1 (Gly46~Glu292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with PE. |
Mouse Serine/threonine- protein kinase VRK1, Vrk1 ELISA KIT |
ELI-16975m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Serine/threonine- protein kinase VRK1, VRK1 ELISA KIT |
ELI-17460h |
Lifescience Market |
96 Tests |
EUR 824 |
Bovine Serine/threonine- protein kinase VRK1, VRK1 ELISA KIT |
ELI-35280b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Serine/threonine-protein kinase VRK1 (VRK1) ELISA Kit |
abx390835-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Vrk1 ELISA Kit| Mouse Serine/threonine-protein kinase VRK1 ELIS |
EF016479 |
Lifescience Market |
96 Tests |
EUR 689 |
VRK1 ELISA Kit| Bovine Serine/threonine-protein kinase VRK1 ELI |
EF012014 |
Lifescience Market |
96 Tests |
EUR 689 |
ELISA kit for Human Serine/threonine-protein kinase VRK1 (VRK1) |
KTE60047-48T |
Abbkine |
48T |
EUR 332 |
- Serine/threonine-protein kinase VRK2 is an a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Serine/threonine-protein kinase VRK1 (VRK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Serine/threonine-protein kinase VRK1 (VRK1) |
KTE60047-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Serine/threonine-protein kinase VRK2 is an a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Serine/threonine-protein kinase VRK1 (VRK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Serine/threonine-protein kinase VRK1 (VRK1) |
KTE60047-96T |
Abbkine |
96T |
EUR 539 |
- Serine/threonine-protein kinase VRK2 is an a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Serine/threonine-protein kinase VRK1 (VRK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Vaccinia Related Kinase 1 (VRK1) Antibody |
20-abx102584 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Vaccinia Related Kinase 1 (VRK1) Antibody |
20-abx175051 |
Abbexa |
|
|
|
Anti-VRK1 (human) (1F6) Monoclonal Antibody |
M03396 |
BosterBio |
100ug |
EUR 397 |
Description: Mouse Monoclonal VRK1 (human) (1F6) Antibody. Validated in WB and tested in Human. |
Human VRK1 shRNA Plasmid |
20-abx955093 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse VRK1 shRNA Plasmid |
20-abx973379 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAC600Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VRK1 (Gly46~Glu292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with APC-Cy7. |
Monoclonal VRK1 Antibody (Center)(Ascites), Clone: 1015CT2.1.1 |
AMM02470G |
Leading Biology |
100μl |
EUR 484 |
Description: A Monoclonal antibody against Human VRK1 (Center)(Ascites). The antibodies are raised in Mouse and are from clone 1015CT2.1.1. This antibody is applicable in WB, E |
VRK1 ORF Vector (Human) (pORF) |
ORF035819 |
ABM |
1.0 ug DNA |
EUR 405 |
Vrk1 ORF Vector (Rat) (pORF) |
ORF079024 |
ABM |
1.0 ug DNA |
EUR 506 |
Vrk1 ORF Vector (Mouse) (pORF) |
ORF061658 |
ABM |
1.0 ug DNA |
EUR 506 |
Vrk1 ORF Vector (Mouse) (pORF) |
ORF061659 |
ABM |
1.0 ug DNA |
EUR 506 |
Vrk1 ORF Vector (Mouse) (pORF) |
ORF061660 |
ABM |
1.0 ug DNA |
EUR 506 |
VRK1 sgRNA CRISPR Lentivector set (Human) |
K2620201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Vrk1 sgRNA CRISPR Lentivector set (Mouse) |
K4353401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Vrk1 sgRNA CRISPR Lentivector set (Rat) |
K6439101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Recombinant Vaccinia Related Kinase 1 (VRK1) |
4-RPC600Hu01 |
Cloud-Clone |
-
EUR 501.41
-
EUR 237.00
-
EUR 1605.28
-
EUR 601.76
-
EUR 1103.52
-
EUR 398.00
-
EUR 3863.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q99986
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 29.9kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Vaccinia Related Kinase 1 expressed in: E.coli |
Human Vaccinia Related Kinase 1 (VRK1) Protein |
20-abx069616 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2165.00
-
EUR 829.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
VRK1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2620202 |
ABM |
1.0 ug DNA |
EUR 154 |
VRK1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2620203 |
ABM |
1.0 ug DNA |
EUR 154 |
VRK1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2620204 |
ABM |
1.0 ug DNA |
EUR 154 |
Vrk1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4353402 |
ABM |
1.0 ug DNA |
EUR 154 |
Vrk1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4353403 |
ABM |
1.0 ug DNA |
EUR 154 |
Vrk1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4353404 |
ABM |
1.0 ug DNA |
EUR 154 |
Vrk1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6439102 |
ABM |
1.0 ug DNA |
EUR 154 |
Vrk1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6439103 |
ABM |
1.0 ug DNA |
EUR 154 |
Vrk1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6439104 |
ABM |
1.0 ug DNA |
EUR 154 |
VRK1 Protein Vector (Rat) (pPB-C-His) |
PV316094 |
ABM |
500 ng |
EUR 603 |
VRK1 Protein Vector (Rat) (pPB-N-His) |
PV316095 |
ABM |
500 ng |
EUR 603 |
VRK1 Protein Vector (Rat) (pPM-C-HA) |
PV316096 |
ABM |
500 ng |
EUR 603 |
VRK1 Protein Vector (Rat) (pPM-C-His) |
PV316097 |
ABM |
500 ng |
EUR 603 |
VRK1 Protein Vector (Human) (pPB-C-His) |
PV143274 |
ABM |
500 ng |
EUR 552 |
VRK1 Protein Vector (Human) (pPB-N-His) |
PV143275 |
ABM |
500 ng |
EUR 552 |
VRK1 Protein Vector (Human) (pPM-C-HA) |
PV143276 |
ABM |
500 ng |
EUR 552 |
VRK1 Protein Vector (Human) (pPM-C-His) |
PV143277 |
ABM |
500 ng |
EUR 552 |
VRK1 Protein Vector (Mouse) (pPB-C-His) |
PV246630 |
ABM |
500 ng |
EUR 603 |
VRK1 Protein Vector (Mouse) (pPB-N-His) |
PV246631 |
ABM |
500 ng |
EUR 603 |
VRK1 Protein Vector (Mouse) (pPM-C-HA) |
PV246632 |
ABM |
500 ng |
EUR 603 |
VRK1 Protein Vector (Mouse) (pPM-C-His) |
PV246633 |
ABM |
500 ng |
EUR 603 |
VRK1 Protein Vector (Mouse) (pPB-C-His) |
PV246634 |
ABM |
500 ng |
EUR 603 |
VRK1 Protein Vector (Mouse) (pPB-N-His) |
PV246635 |
ABM |
500 ng |
EUR 603 |
VRK1 Protein Vector (Mouse) (pPM-C-HA) |
PV246636 |
ABM |
500 ng |
EUR 603 |
VRK1 Protein Vector (Mouse) (pPM-C-His) |
PV246637 |
ABM |
500 ng |
EUR 603 |
VRK1 Protein Vector (Mouse) (pPB-C-His) |
PV246638 |
ABM |
500 ng |
EUR 603 |
VRK1 Protein Vector (Mouse) (pPB-N-His) |
PV246639 |
ABM |
500 ng |
EUR 603 |
VRK1 Protein Vector (Mouse) (pPM-C-HA) |
PV246640 |
ABM |
500 ng |
EUR 603 |
VRK1 Protein Vector (Mouse) (pPM-C-His) |
PV246641 |
ABM |
500 ng |
EUR 603 |
Vrk1 3'UTR GFP Stable Cell Line |
TU172146 |
ABM |
1.0 ml |
Ask for price |
VRK1 3'UTR GFP Stable Cell Line |
TU078307 |
ABM |
1.0 ml |
EUR 1394 |
Vrk1 3'UTR Luciferase Stable Cell Line |
TU122146 |
ABM |
1.0 ml |
Ask for price |
VRK1 3'UTR Luciferase Stable Cell Line |
TU028307 |
ABM |
1.0 ml |
EUR 1394 |
Vrk1 3'UTR Luciferase Stable Cell Line |
TU223270 |
ABM |
1.0 ml |
Ask for price |
Vrk1 3'UTR GFP Stable Cell Line |
TU273270 |
ABM |
1.0 ml |
Ask for price |
Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit |
20-abx153490 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Vaccinia Related Kinase 1 (VRK1) CLIA Kit |
20-abx493787 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Vaccinia Related Kinase 1 (VRK1)ELISA Kit |
201-12-2457 |
SunredBio |
96 tests |
EUR 440 |
- This Vaccinia Related Kinase 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit |
SEC600Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vaccinia Related Kinase 1 (VRK1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vaccinia Related Kinase 1 (VRK1) in serum, plasma and other biological fluids. |
Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit |
SEC600Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vaccinia Related Kinase 1 (VRK1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vaccinia Related Kinase 1 (VRK1) in serum, plasma and other biological fluids. |
Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit |
SEC600Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vaccinia Related Kinase 1 (VRK1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vaccinia Related Kinase 1 (VRK1) in serum, plasma and other biological fluids. |
VRK1 Rabbit Polyclonal Antibody